2012 IMPACT FACTOR: 1.274

Nefrología Suplemento Extraordinario 2011;2(1):11-20 | Doi. 10.3265/NefrologiaSuplementoExtraordinario.pre2011.Mar.10890
Métodos de diagnóstico genético de las enfermedades renales hereditarias. El consejo genético

Enviado a Revisar: 16 Mar. 2011 | Aceptado el: 16 Mar. 2011  | En Publicación: 25 May. 2011
Elisabeth Ars
Laboratorio de Biología Molecular. Fundación Puigvert.
Correspondencia para Elisabeth Ars, Laboratorio de Biología Molecular, Fundación Puigvert
Tabla 1 - Principales características de las enfermedades genéticas monogénicas y poligénicas
Tabla 2 - Clasificación de las variantes de secuencia del ADN
Figura 1 - Diagnóstico genético prenatal de una familia con poliquistosis renal autosómica recesiva.
Figura 2 - Herramientas in silico para evaluar la patogenicidad de las variantes de secuencia no clasificadas.
Figura 3 - Algoritmo del consejo genético.

 

CONCEPTOS BÁSICOS DE DIAGNÓSTICO GENÉTICO

 

El diagnóstico genético consiste en analizar el material genético, el ácido desoxirribonucleico (ADN) o el ácido ribonucleico (ARN), obtenido de una muestra humana con el fin de detectar variantes de secuencia del ADN asociadas a una enfermedad. En genética médica se denominan mutaciones patogénicas a las variantes de secuencia que causan enfermedad, las cuales generalmente se encuentran en una frecuencia inferior al 1% en la población general. En cambio, se denominan polimorfismos o variantes neutras a las variantes de secuencia que per se no son patogénicas y que están presentes en una frecuencia superior al 1% en la población.

 

Actualmente, el diagnóstico genético es aplicable principalmente a las enfermedades monogénicas, que son aquellas en las que una mutación patogénica en un único gen (de unos 25.000 genes que contiene nuestro genoma) es suficiente para causar la enfermedad. En cambio, las enfermedades poligénicas, también denominadas multifactoriales o complejas, son causadas tanto por factores genéticos, múltiples variantes de secuencia en distintos genes que proporcionan un riesgo genético o predisposición a desarrollar la enfermedad, como por factores ambientales. Estas últimas no se transmiten con los patrones mendelianos clásicos y muestran una agregación familiar mucho menor.

 

Las enfermedades monogénicas son enfermedades raras o minoritarias, es decir, con una prevalencia menor de 5 casos por cada 10.000 habitantes, mientras que las enfermedades poligénicas son comunes en la población adulta. El patrón de herencia determina el grado de causalidad genética (tabla 1). En las enfermedades monogénicas recesivas existe una estrecha correlación genotipo-fenotipo, lo que indica que el fenotipo de la enfermedad es determinado de forma prácticamente exclusiva por la/s mutación/es patogénica/s en el gen causante (penetrancia completa), con un alto poder predictivo del análisis genético. Las enfermedades recesivas usualmente se manifiestan prenatalmente, en la infancia o adolescencia (p. ej., la poliquistosis renal autosómica recesiva, el síndrome nefrótico córtico-resistente, la nefronoptisis, etc.). Las enfermedades con un patrón de herencia dominante típicamente se manifiestan en el adulto (p. ej., la poliquistosis renal autosómica dominante) y presentan un grado de correlación genotipo-fenotipo más reducido que las recesivas, puesto que en las dominantes puede existir penetrancia incompleta y expresión variable.

 

La penetrancia se define como la probabilidad de manifestar un fenotipo cuando se es portador de un genotipo determinado. Si tener un gen mutado es sinónimo de presentar una determinada enfermedad la penetrancia es completa, en cambio, si se puede poseer la mutación y no estar afectado por la enfermedad la penetrancia es incompleta (inferior al 100%). Debe tenerse en cuenta que la penetrancia depende de la edad, así por ejemplo, para la poliquistosis renal autosómica dominante se han establecido unos criterios diagnósticos ecográficos en que el número de quistes depende de la edad del paciente1. En general, para enfermedades dominantes la penetrancia es incompleta (al menos hasta cierta edad) mientras que para la mayoría de enfermedades recesivas es completa.

 

La expresividad es el grado de expresión de un fenotipo. Se considera que la expresividad es variable cuando la manifestación de un fenotipo varía entre individuos que comparten una misma mutación/es. Esta variabilidad fenotípica puede ser tanto interfamiliar, entre individuos no relacionados, como intrafamiliar, miembros afectados de una misma familia y, por tanto, portadores de la misma mutación pueden presentar fenotipos muy distintos. Cabe destacar que muchas enfermedades presentan una expresividad variable con la edad, de manera que un fenotipo muy leve en la infancia no excluye un desarrollo moderado o grave de la enfermedad. La penetrancia incompleta y la expresividad variable en una enfermedad monogénica pueden explicarse sobre la base de la existencia de genes modificadores de la severidad de la enfermedad y por la influencia de factores ambientales, que modulan el efecto del gen mayor, principal responsable de la enfermedad.

 

 

En las enfermedades poligénicas (p. ej., la hipertensión arterial), la correlación genotipo-fenotipo es muy baja y usualmente sólo puede asignarse un riesgo relativo a una variante genética. Recientemente, determinadas variantes en el gen de un tipo de miosina (MHY9) se han asociado a un riesgo incrementado de dos a cuatro veces de presentar glomeruloesclerosis segmentaria y focal e insuficiencia renal crónica terminal (IRCT) en afroamericanos comparado con europeos2. Las enfermedades poligénicas generalmente se manifiestan en los adultos y son mucho más frecuentes que las enfermedades monogénicas. Las variantes genéticas de riesgo de enfermedades poligénicas pueden identificarse en estudios de asociación de genoma completo (GWAS, por sus siglas en inglés Genome-wide association study)3. En estos estudios se compara el genoma (ADN completo) de personas con una enfermedad o afección con el genoma de personas sin esa enfermedad o afección. Estos estudios ayudan a identificar los genes implicados en una enfermedad, pero su aplicabilidad clínica está muy lejos de ser una realidad.

 

La identificación de genes responsables de enfermedades renales monogénicas ha ofrecido nuevas herramientas para su clasificación y ha permitido situar la genética molecular en la línea central del estudio y diagnóstico de las nefropatías hereditarias4-6. Además, la caracterización de las proteínas codificadas por estos genes supone el punto de partida de estudios fisiopatológicos y posibilita el desarrollo de estrategias terapéuticas para estas enfermedades. Otro importante reto es establecer correlaciones entre los aspectos clínicos y genéticos de pacientes afectados por la misma nefropatía hereditaria. El conocimiento de la mutación que causa una enfermedad monogénica representa uno de los ejemplos más importantes de diagnóstico de medicina personalizada, puesto que ser portador de la mutación implica un riesgo de prácticamente el 100% de desarrollar la enfermedad a una edad determinada6.

 

El resultado de un diagnóstico genético se caracteriza por ser vitalicio, por tener importantes implicaciones para los miembros de una familia y por influir en las decisiones reproductivas. Por ello, es esencial que siempre vaya acompañado del correspondiente consejo genético o asesoramiento genético.

 

MÉTODOS DE DIAGNÓSTICO GENÉTICO-MOLECULAR

 

Las metodologías que se utilizan para el diagnóstico genético son muy variadas, permitiendo desde el estudio de cromosomas hasta el análisis del cambio de una base nucleotídica. En el ámbito cromosómico, para el estudio de alteraciones del número y estructura de los 46 cromosomas humanos se realiza un estudio citogenético (cariotipo) y para el estudio de alteraciones cromosómicas más pequeñas, se utiliza la hibridación in situ fluorescente (FISH), la cual incorpora elementos de biología molecular al usar sondas marcadas con fluorocromos. El diagnóstico genético-molecular se puede considerar un análisis a mayor aumento para el que se requieren técnicas que examinan exhaustivamente secuencias específicas de ADN o ARN. Se utilizan para enfermedades en que está descrito el gen responsable o al menos su localización y permiten identificar la mutación patogénica o el haplotipo ligado a la enfermedad.

 

Para las enfermedades renales monogénicas el diagnóstico genético-molecular se puede realizar mediante dos aproximaciones: 1) análisis directo, y 2) análisis indirecto (figura 1).

 

Análisis directo

 

El análisis directo tiene por objetivo identificar o descartar una mutación patogénica en un determinado gen. Se basa en el análisis específico de la secuencia de nucleótidos de un gen para determinar si es normal o mutada. Es imprescindible, por tanto, saber qué gen debe ser examinado, así como conocer la secuencia de referencia (wild type) de dicho gen. Existen dos tipos de análisis directo: 1) confirmación o exclusión de una variante de secuencia conocida (genotipado), y 2) análisis completo de la secuencia codificadora de un gen (re-secuenciación o cribado mutacional).

 

El análisis directo es un estudio individual, por lo que puede aplicarse tanto a casos esporádicos (de novo) como familiares. En los casos familiares, el análisis de la secuencia completa del gen únicamente se realiza en el familiar con el diagnóstico clínico certero de la enfermedad (caso índice o probando) o el que tenga mayor sospecha diagnóstica y, si en éste se halla la mutación, en el resto de familiares únicamente se analiza el segmento específico del gen donde se localiza la mutación. El análisis directo de un gen causante de una determinada enfermedad en múltiples pacientes lleva a conocer distintas mutaciones patogénicas que pueden manifestarse con distintos grados de severidad/fenotipos de la enfermedad, por lo que permite establecer o analizar correlaciones genotipo-fenotipo.

 

Existen distintos métodos para analizar la presencia de mutaciones en un gen. El que se aplique un método u otro dependerá del tipo de mutación y de las características del gen en estudio. Actualmente, la secuenciación del ADN es la técnica más utilizada para el análisis directo y se considera el método de referencia. Las técnicas de secuenciación han avanzado espectacularmente durante los últimos 15 años. Aunque existen distintas estrategias, la mayoría de laboratorios clínicos utilizan la secuenciación basada en el método de Sanger7, que usa dideoxinucleótidos trifosfato como terminadores de la cadena de ADN. Generalmente se analiza toda la secuencia del gen que codifica para proteína, es decir, el conjunto de exones. Para ello se requiere una muestra de sangre periférica u otro tejido (mucosa bucal, pelo, piel, etc.) del consultante, a partir de la cual se aísla su ADN genómico. A continuación mediante la reacción en cadena de la polimerasa (PCR, del inglés Polymerase Chain Reaction) se amplifican todos los exones, junto con las secuencias intrónicas flanqueantes de cada exón, que finalmente mediante la reacción de secuenciación son examinados nucleótido a nucleótido. Con esta técnica se encuentra cualquier diferencia con respecto a la secuencia de referencia del gen. Las secuencias de referencia se obtienen de bases de datos públicas como GenBank8 mantenida por el National Center for Biotechnology Information (NCBI). Es importante que las mutaciones sean descritas según la nomenclatura internacional siguiendo las recomendaciones de la Human Genome Variation Society (HGVS)9.

 

Mediante la secuenciación del ADN se encuentran distintos tipos de variantes de secuencia que alteran a un único nucleótido (puntuales) o a unos pocos (tabla 2). Las variantes de secuencia se pueden clasificar como mutaciones claramente patogénicas si trucan la proteína resultante o si alteran las secuencias canónicas de splicing (AG/GT). En este grupo se hallan las mutaciones denominadas sin sentido (nonsense) que originan un codón de stop (UAG, UAA o UGA), que termina prematuramente la traducción produciendo una proteína truncada. También las mutaciones denominadas de cambio de pauta de lectura (frameshift) que implican la inserción o la deleción de uno o varios nucleótidos cuyo número no es un múltiplo de tres, de forma que la pauta de lectura de la secuencia del ARNm (ARN mensajero) queda alterada. El resultado es una proteína truncada, debido a la creación de un codón de stop más adelante. Por último, las mutaciones de splicing que alteran el procesamiento del ARNm en la eliminación de los intrones y unión de los exones. Las mutaciones de splicing pueden producirse en distintas partes de un gen10, pero las que se consideran claramente patogénicas son las que modifican las secuencias canónicas donadoras (GT) o aceptadoras (AG) de splicing situadas en los dos nucleótidos iniciales y finales de cada intrón.

 

Por otro lado, algunas variantes de secuencia tienen una repercusión funcional incierta en la proteína resultante puesto que no alteran su pauta de lectura (in frame). Estos cambios a priori son considerados variantes de secuencia no clasificadas (UCVs, unclassified sequence variants). En este grupo se incluyen las variantes de cambio de aminoácido denominadas de cambio de sentido (missense), las deleciones o inserciones de un número de nucleótidos múltiplo de tres y las variantes de secuencia potencialmente implicadas en el splicing pero que no alteran los nucleótidos canónicos (AG/GT). El análisis funcional de estas variantes teóricamente sería la mejor forma de determinar su patogenicidad, no obstante, es una estrategia muy laboriosa que no se puede abordar en un laboratorio de diagnóstico genético. Por ello, se ha optado por utilizar distintas herramientas in silico (figura 2) para evaluar la patogenicidad de estas variantes: 1) la búsqueda de datos sobre la variante tanto en la bibliografía como en bases de datos de mutaciones como la Human Gene Mutation Database11 o Locus Specific Mutation Database12 y de polimorfismos como la NCBI SNP Database13; 2) el grado de conservación del aminoácido en un alineamiento múltiple de secuencias de proteínas ortólogas (de otras especies)14,15; 3) la diferencia bioquímica y biofísica entre el aminoácido original y el mutado16; 4) distintos algoritmos in silico que predicen la patogenicidad como Polyphen17,18 y SIFT19,20; 5) la segregación de la variante con la enfermedad en una familia, y 6) el análisis de cromosomas control. Recientemente, para distintos genes implicados en enfermedades renales hereditarias como PKD1, PKD2, PKHD121,22, NPHS1, NPHS2 y TRPC623-25 se ha descrito un sistema de puntuación para cada uno de los parámetros mencionados que permite clasificar la variante a priori no clasificada como: 1) muy probablemente patogénica; 2) probablemente patogénica; 3) variante de efecto indeterminado, y 4) probablemente neutra.

 

Si después de este análisis la variante se clasifica como muy probablemente patogénica se considera que es la mutación causante de la enfermedad, en cambio, si se clasifica como probablemente patogénica o con efecto indeterminado se considera como «variante de significado clínico incierto». Por último, las variantes que se clasifican como probablemente neutra se consideran polimorfismos.

 

Para la confirmación o exclusión de una variante de secuencia conocida también se pueden utilizar otras técnicas más económicas que la secuenciación del ADN como la digestión del ADN con enzimas de restricción, análisis de conformación de la cadena simple (SSCP), análisis del heterodúplex (HD), electroforesis en gradientes de geles desnaturalizantes (DGGE), cromatografia líquida de alta resolución desnaturalizante (DHPLC) o high resolution meelting (HRM). Para genes de gran tamaño con múltiples exones que se expresen en algún tejido fácilmente accesible (sangre, cabello, etc.) se pueden utilizar técnicas en las que el material de partida es el ARN que al no tener intrones permite amplificar múltiples exones en una única PCR posibilitando un análisis más rápido de la región codificadora. Esta estrategia se utiliza en algunos laboratorios para el diagnóstico directo del síndrome de Alport ligado al cromosoma X26.

 

Otro tipo de mutaciones claramente patogénicas que no pueden ser detectadas mediante secuenciación son las deleciones y duplicaciones grandes que implican a un exón entero, a múltiples exones o a un gen completo. Para identificar este tipo de mutaciones se realiza un análisis de número de copia. Una de las técnicas más utilizadas en los últimos años es la amplificación dependiente de ligación de múltiples sondas (multiplex ligation-dependent probe amplification, MLPA)27. Para enfermedades renales, esta técnica ha sido empleada para detectar grandes deleciones intragénicas en el gen LMX1B causante del síndrome de Nail Patella28 y en los genes SLC3A1 y SLC7A9, responsables de la cistinuria29. También pueden detectarse estas deleciones e inserciones con PCR cuantitativa a tiempo real, PCR de amplio rango, Southern blot o estudios de perdidas de heterozigosidad (LOH). Para identificar deleciones e inserciones mayores (de 40 kb a varias Mb) se utilizan electroforesis en campos pulsantes (PFGE) e hibridación in situ fluorescente (FISH).

 

Además de la dificultad de distinguir una mutación patogénica de un polimorfismo para las variantes de secuencia que no truncan la proteína, otra importante limitación del análisis directo es que su sensibilidad es siempre inferior al 100%, es decir, que no es posible detectar todas las mutaciones patogénicas. Esto implica que un análisis directo negativo no permite descartar el diagnóstico de la enfermedad. Existen varias posibles explicaciones para un resultado falso negativo: a) que la mutación no pueda ser detectada con la técnica que se ha utilizado (p. ej., una gran deleción si se está secuenciando el gen); b) que la mutación se encuentre en una región no analizada (p. ej., un intrón o una región reguladora), y c) que la mutación se encuentre en otro gen5. Esta última posibilidad es muy probable para enfermedades con elevada heterogeneidad genética, es decir, que la enfermedad puede estar causada por mutaciones en diferentes genes de manera independiente, como la nefronoptisis para la que hasta el momento se han identificado 9 genes que pueden causar la enfermedad, pero que con el análisis de los 9 genes no se detecta ninguna mutación en un 70% de los casos30.

 

Análisis indirecto

 

Históricamente, el análisis de ligamiento fue el primer tipo de diagnóstico genético-molecular ampliamente usado para el estudio de las enfermedades hereditarias. Se trata de un estudio genético familiar que se basa en el análisis de haplotipos. Un haplotipo es la combinación de alelos (siendo un alelo cada una de las variantes alternativas de un mismo gen en una posición concreta [locus] o de un marcador particular en un cromosoma) de distintos marcadores polimórficos localizados en un mismo segmento cromosómico que se heredan juntos. El análisis de ligamiento estudia en una familia cómo segregan los haplotipos de la región cromosómica en la que se localiza el gen causante e identifica el haplotipo de riesgo ligado a la enfermedad. Se trata de un análisis indirecto puesto que no identifica la mutación patogénica sino que compara los haplotipos de los distintos familiares para hallar el haplotipo de riesgo, aquel que comparten todos los afectados y que no posee ninguno de los familiares sanos.

 

Los marcadores genéticos más utilizados en el análisis de ligamiento son los microsatélites o short tandem repeats (STRs), que consisten en secuencias cortas, generalmente de 2 a 5 nucleótidos, que se repiten en tándem un número de veces variable según el individuo. Por ejemplo, el microsatélite «C-A-T-A» puede presentarse tres veces en un individuo (•••CATACATACATA•••), y cinco veces en otro (•••CATACATACATACATACATA•••). Estos marcadores son altamente informativos, ya que presentan un gran número de alelos, siendo muy elevada la probabilidad de encontrar dos alelos diferentes (heterocigosidad) en el mismo individuo. También se pueden utilizar polimorfismos de un solo nucleótido o SNPs (Single Nucleotide Polymorphisms) que son mucho más abundantes en el genoma que los microsatélites pero son menos informativos ya que generalmente sólo presentan dos alelos.

 

Técnicamente, el análisis indirecto se puede considerar mucho más rápido, sencillo y económico que el análisis directo. El gran inconveniente del diagnóstico indirecto es que sólo se puede aplicar a los casos familiares siendo necesaria la participación en el estudio de múltiples familiares para los que es imprescindible conocer si están afectados o no. Además, es imperativo que alguno de los miembros de la familia tenga un diagnóstico clínico 100% certero de la enfermedad (probando o caso índice). Si no existe un diagnóstico clínico seguro no se podrá aplicar esta aproximación indirecta. Es importante destacar que para las enfermedades monogénicas con heterogeneidad genética debe realizarse el análisis de ligamiento a todos los posibles genes causantes. En este caso, el estudio sólo será informativo si se confirma el ligamiento a un gen y se descarta el ligamiento al otro u otros genes que pueden causar la enfermedad. Además, distintos factores como la recombinación genética, la baja informatividad de los marcadores genéticos, la heterogeneidad genética, el mosaicismo, la no paternidad y otros pueden complicar este análisis e incluso en ocasiones imposibilitan la obtención resultados concluyentes. Todo esto indica que se debe ser muy cauto con este tipo de aproximación diagnóstica.

 

 

APLICACIONES DEL DIAGNÓSTICO GENÉTICO

Las principales aplicaciones clínicas del diagnóstico genético son el diagnóstico prenatal, preimplantacional y presintomático, la confirmación diagnóstica y el estudio de portadores.

 

El diagnóstico genético prenatal consiste en un análisis genético del feto para determinar si presenta la mutación o mutaciones que causan la enfermedad en su familia. Es imprescindible que la familia haya realizado un estudio genético previo al embarazo en el que se haya identificado la mutación o mutaciones que causan la enfermedad o los haplotipos ligados a la enfermedad en su familia. Generalmente el análisis genético fetal se realiza a partir de una biopsia de vellosidades coriónicas que se obtiene entre las semanas 10-12 del embarazo. El diagnóstico prenatal normalmente se solicita en enfermedades muy graves con un patrón de herencia autosómico recesivo como la poliquistosis renal autosómica recesiva o el síndrome nefrótico congénito. En cambio, para enfermedades autosómicas dominantes con inicio en el adulto la demanda es muy baja. Una cuestión que el especialista debe explicar con claridad a los familiares, es que la solicitud de un estudio prenatal implica una determinación clara de interrupción voluntaria del embarazo en caso de que el feto esté afectado, puesto que se trata de un prueba invasiva con un riesgo de aborto del 0,5-2%.

 

El diagnóstico genético preimplantacional (DGP) combina las técnicas de reproducción asistida con el diagnóstico genético de los embriones cultivados in vitro y permite la selección de los embriones libres de una determinada alteración genética para su transferencia en el útero materno. Es imprescindible que la familia haya realizado un estudio genético previo en el que se haya identificado la mutación/es que causan la enfermedad o los haplotipos ligados a la enfermedad en su familia. Antes de iniciar el proceso la pareja debe superar un estudio de la aptitud (ginecológico y andrológico) para técnicas de reproducción asistida y, por otro lado, debe realizarse un estudio de informatividad que consiste en la adecuación de las técnicas para detectar el defecto genético en una única célula con una fiabilidad que supere el 90%. Superados estos pasos se inicia la reproducción asistida y cuando los embriones obtenidos se encuentran en un estadio de 6-8 células son biopsiados para la obtención de uno o dos blastómeros. Estos blastómeros son analizados genéticamente y se seleccionan los embriones que no son portadores de la anomalía genética y sólo éstos son transferidos al útero materno, asegurando una descendencia sana. No obstante, dado que los errores técnicos asociados al análisis de una única célula no son menospreciables, la European Society of Human Reproduction and Embriology (ESHRE) recomienda la realización de un diagnóstico prenatal del feto.

 

El diagnóstico presintomático ofrece gran interés como diagnóstico precoz en aquellas situaciones susceptibles de la aplicación de tratamientos preventivos, disminución de riesgos, modificación de hábitos de vida, etc.

 

La confirmación diagnóstica que generalmente se solicita en los casos en que existe una sospecha clínica a pesar de no cumplirse los criterios diagnósticos de ésta.

 

El estudio de portadores que determina el riesgo de tener un hijo afectado por una enfermedad autosómica recesiva o ligada al cromosoma X. Es aplicable en familias en las que se haya identificado la mutación responsable de la enfermedad o en las que se conozca cuál es el haplotipo de riesgo ligado a la enfermedad. También se puede realizar en el caso de tratarse de enfermedades causadas por genes con poca variabilidad mutacional o con un número limitado de mutaciones recurrentes. El resultado de un estudio de portadores puede conllevar un futuro diagnóstico prenatal o preimplantacional y, por tanto, tiene importantes implicaciones en las decisiones reproductivas.

 

CONSEJO GENÉTICO

 

El consejo o asesoramiento genético es una de las aplicaciones más importantes de la genética humana. Se trata de un proceso de comunicación mediante el cual, un profesional especializado asesora al paciente y/o a la familia que padecen una enfermedad genética, ofreciéndoles información sobre la enfermedad, riesgo de padecerla o transmitirla, prevenirla o tratarla y les ofrece una guía para tomar sus propias decisiones de una forma autónoma, no dirigida.

 

El consejo genético tiene, por tanto, tres etapas principales: establecimiento de un diagnóstico preciso, cálculo de riesgo y transmisión de la información (figura 3)31.

 

Diagnóstico de enfermedades genéticas

 

El establecimiento de un diagnóstico preciso es clave para una correcta estimación de los riesgos de recurrencia. El diagnóstico de una enfermedad genética requiere, al igual que el de cualquier otra enfermedad, una correcta exploración física y anamnesis, siendo particularmente importante la evaluación de los antecedentes familiares y la posible consanguinidad. Es necesaria la realización de un árbol genealógico completo utilizando los símbolos convencionales32, lo que permitirá que cualquier otro especialista interprete correctamente la información. Es importante determinar de forma precisa el estado de «afectado», «sano», «portador» o «en riesgo» de cada familiar, siendo a veces necesario para ello realizar exploraciones dirigidas a algunos miembros de la familia. Estas exploraciones son especialmente necesarias en enfermedades con expresividad variable. En algunos casos será necesario realizar un estudio genético.

 

En la interpretación de los resultados de un análisis genético es fundamental la experiencia de un genetista y/o de un clínico con conocimientos de genética, puesto que es necesario conocer la diferencia entre una mutación patogénica y un polimorfismo o las variaciones en expresión o penetrancia de una determinada enfermedad.

 

Cálculo de riesgo

 

Una vez establecido el diagnóstico de la enfermedad hereditaria es posible el cálculo de riesgo de recurrencia o la probabilidad de estar afectado.

 

En las enfermedades poligénicas en las que la genética juega un papel en la etiología, pero que no se heredan de manera simple, generalmente se proporciona un riesgo empírico basado en los datos poblacionales observados que puede variar según la zona o ante la presencia de otro familiar afectado en la familia. En estas enfermedades el cálculo preciso del riesgo de recurrencia es complejo pero afortunadamente es bajo.

 

En cambio, para las enfermedades monogénicas el riesgo de recurrencia es elevado. Se puede estimar un riesgo a priori en base al patrón de herencia de la enfermedad (riesgo mendeliano): 50% para un paciente afectado de una enfermedad autosómica dominante, 25% para una pareja de portadores de una enfermedad autosómica recesiva, mientras que para una enfermedad ligada al cromosoma X, se debe distinguir entre una mujer portadora cuyo riesgo de recurrencia es del 50% y un hombre afectado cuyas hijas serán todas portadoras y ninguno de su hijos hombres se verá afectado. Este riesgo a priori se puede modificar para obtener una estimación más precisa considerando la probabilidad condicional, es decir, combinando información de distintas fuentes como la edad a la que comienza a manifestarse la enfermedad, si alguno de sus hijos está o no afectado, el resultado de un análisis genético o la penetrancia, si es incompleta. A partir del conocimiento de las probabilidades previa y condicional es posible calcular el riesgo modificado o riesgo a posteriori, que es la probabilidad conjunta de estar afectado (o de ser portador) dividida por la probabilidad conjunta de no estar afectado más la probabilidad conjunta de estar afectado. Este método para calcular probabilidades se basa en el teorema de Bayes (1763) y está explicado con gran claridad y con ejemplos en la revisión de Ogino y Wilson33.

 

Transmisión de la información

 

El genetista o especialista clínico debe informar al paciente y/o familiar sobre las características clínicas de la enfermedad, el curso probable de ésta y los tratamientos disponibles, así como ayudarle a comprender el resultado de un análisis genético, en caso de que se haya realizado. Si se trata de una enfermedad monogénica debe explicarle el patrón con el que se hereda la enfermedad, el riesgo de recurrencia y la probabilidad de estar afectado o de ser portador. Si el paciente o familiar se encuentra en edad reproductiva es muy importante plantearle las alternativas al riesgo de recurrencia. Estas opciones reproductivas incluyen el diagnóstico prenatal, el diagnóstico genético preimplantacional, así como la posibilidad de no realizar ningún tipo de intervención o bien de recurrir a donantes de semen u óvulos o a la adopción, explicándole en qué consiste cada una de estas posibilidades.

 

La transmisión de esta información debe ser lo más clara y objetiva posible, evitando tecnicismos y favoreciendo la elección individual según la percepción personal del riesgo, los objetivos y valores. El resultado de un estudio genético se debe dar por escrito puesto que, como se ha comentado, tiene validez para toda la vida y el paciente podrá entregarlo a distintos especialistas. También es importante dar al paciente información por escrito sobre su enfermedad para que pueda releerla, dándole la oportunidad de una nueva consulta para plantear nuevas dudas.

 

En caso de que exista alguna asociación de afectados como la asociación para la información y la investigación de enfermedades renales genéticas España (AIRG-E)34, es conveniente informar de su existencia. En algunos casos puede estar indicada la ayuda psicológica, puesto que cada paciente y cada familia tienen un proceso diferente a la hora de aceptar el diagnóstico y sus repercusiones.

 

 

PUNTOS CLAVE

1. El uso de análisis genéticos con fines diagnósticos está siendo integrado a la rutina asistencial de forma exponencial en los últimos años, por lo que es importante que los clínicos se familiaricen con las aproximaciones técnicas y las implicaciones éticas de estos métodos.

2. Actualmente, el diagnóstico genético es aplicable principalmente a las enfermedades monogénicas y se realiza mayoritariamente mediante secuenciación del gen causante (diagnóstico directo) o mediante análisis de ligamiento (diagnóstico indirecto).

3. El diagnóstico directo tiene dos limitaciones principales: a) la dificultad de determinar la patogeneidad/neutralidad de las variantes de secuencia que no truncan la proteína resultante, y b) que un resultado negativo no permite descartar el diagnóstico de la enfermedad.

4. El diagnóstico indirecto sólo se puede aplicar a los casos familiares siendo necesaria la participación en el estudio de múltiples familiares para los que es imprescindible conocer si están afectados o no.

5. El resultado de un diagnóstico genético se caracteriza por ser vitalicio, por tener importantes implicaciones para los miembros de una familia y por influir en las decisiones reproductivas. Por ello, es esencial que siempre vaya acompañado del correspondiente consejo genético o asesoramiento genético.

 

6. El consejo genético es un proceso de comunicación que incluye tres fases: establecimiento de un diagnóstico preciso, cálculo de riesgo y transmisión de la información.

7. Las principales aplicaciones clínicas del diagnóstico genético son el diagnóstico prenatal, preimplantacional y presintomático, la confirmación diagnóstica y el estudio de portadores.

Referencias Bibliográficas

1. Pei Y, Obaji J, Dupuis A et al. Unified criteria for ultrasonographic diagnosis of ADPKD. J Am Soc Nephrol 2009;20(1):205-12.[Pubmed]

2. Kao WH, Klag MJ, Meoni LA et al. MYH9 is associated with nondiabetic end-stage renal disease in African Americans. Nat Genet 2008;40(10):1185-92.[Pubmed]

3. Kottgen A. Genome-wide association studies in nephrology research. Am J Kidney Dis 2010;56(4):743-58.[Pubmed]

4. Ars E, Torra R, Oliver A. Molecular diagnosis of hereditary renal diseases. Nefrologia 2003;23(Suppl 1):2-10.[Pubmed]

5. Guay-Woodford LM, Knoers NV. Genetic testing: considerations for pediatric nephrologists. Semin Nephrol 2009;29(4):338-48.[Pubmed]

6. Hildebrandt F. Genetic kidney diseases. Lancet 2010;375(9722):1287-95.[Pubmed]

7. Sanger F, Air GM, Barrell BG et al. Nucleotide sequence of bacteriophage phi X174 DNA. Nature 1977;265(5596):687-95.[Pubmed]

8. GenBank: http://www.ncbi.nlm.nih.gov/genbank/

9. Human Genome Variation Society: http://www.hgvs.org/mutnomen/

10. Ars E, Serra E, Garcia J et al. Mutations affecting mRNA splicing are the most common molecular defects in patients with neurofibromatosis type 1. Hum Mol Genet 2000;9(2):237-47.[Pubmed]

11. Human Gene Mutation Database: http://www.hgmd.cf.ac.uk/ac/index.php

12. Locus Specific Mutation Database: http://www.hgmd.cf.ac.uk/docs/oth_mut.html

13. NCBI SNP Database: http://www.ncbi.nlm.nih.gov/SNP

14. Abkevich V, Zharkikh A, Deffenbaugh AM et al. Analysis of missense variation in human BRCA1 in the context of interspecific sequence variation. J Med Genet 2004;41(7):492-507.[Pubmed]

15. Tavtigian SV, Samollow PB, De SD, Thomas A. An analysis of unclassified missense substitutions in human BRCA1. Fam Cancer 2006;5(1):77-88.[Pubmed]

16. Grantham R. Amino acid difference formula to help explain protein evolution. Science 1974;185(4154):862-4.[Pubmed]

17. Ramensky V, Bork P, Sunyaev S. Human non-synonymous SNPs: server and survey. Nucleic Acids Res 2002;30(17):3894-900.[Pubmed]

18. Sunyaev S, Ramensky V, Bork P. Towards a structural basis of human non-synonymous single nucleotide polymorphisms. Trends Genet 2000;16(5):198-200.[Pubmed]

19. Kumar P, Henikoff S, Ng PC. Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nat Protoc 2009;4(7):1073-81.[Pubmed]

20. Ng PC, Henikoff S. SIFT: Predicting amino acid changes that affect protein function. Nucleic Acids Res 2003;31(13):3812-4.[Pubmed]

21. Rossetti S, Consugar MB, Chapman AB, et al. Comprehensive molecular diagnostics in autosomal dominant polycystic kidney disease. J Am Soc Nephrol 2007;18(7):2143-60.[Pubmed]

22. Gunay-Aygun M, Tuchman M, Font-Montgomery E, et al. PKHD1 sequence variations in 78 children and adults with autosomal recessive polycystic kidney disease and congenital hepatic fibrosis. Mol Genet Metab 2010;99(2):160-73.[Pubmed]

23. Santin S, Garcia-Maset R, Ruiz P, et al. Nephrin mutations cause childhood- and adult-onset focal segmental glomerulosclerosis. Kidney Int 2009;76(12):1268-76.[Pubmed]

24. Santin S, Ars E, Rossetti S, et al. TRPC6 mutational analysis in a large cohort of patients with focal segmental glomerulosclerosis. Nephrol Dial Transplant 2009;24(10):3089-96.[Pubmed]

25. Santin S, Tazon-Vega B, Silva I, et al. Clinical Value of NPHS2 Analysis in Early- and Adult-Onset Steroid-Resistant Nephrotic Syndrome. Clin J Am Soc Nephrol 2010.

26. Tazon-Vega B, Ars E, Burset M, et al. Genetic testing for X-linked Alport syndrome by direct sequencing of COL4A5 cDNA from hair root RNA samples. Am J Kidney Dis 2007;50(2):257-314.[Pubmed]

27. Schouten JP, McElgunn CJ, Waaijer R, Zwijnenburg D, Diepvens F, Pals G. Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification. Nucleic Acids Res 2002;30(12):e57.[Pubmed]

28. Bongers EM, De W, I, Marcelis C, Hoefsloot LH, Knoers NV. Identification of entire LMX1B gene deletions in nail patella syndrome: evidence for haploinsufficiency as the main pathogenic mechanism underlying dominant inheritance in man. Eur J Hum Genet 2008;16(10):1240-4.[Pubmed]

29. Bisceglia L, Fischetti L, Bonis PD et al. Large rearrangements detected by MLPA, point mutations, and survey of the frequency of mutations within the SLC3A1 and SLC7A9 genes in a cohort of 172 cystinuric Italian patients. Mol Genet Metab 2010;99(1):42-52.[Pubmed]

30. Hildebrandt F, Attanasio M, Otto E. Nephronophthisis: disease mechanisms of a ciliopathy. J Am Soc Nephrol 2009;20(1):23-35.[Pubmed]

31. Lorda-Sánchez I, Ramos C, Ayuso C. Consulta genética y diagnóstico genético prenatal. Pediatr Integral 2006;8:559-68.

32. Bennett RL, French KS, Resta RG, Doyle DL. Standardized human pedigree nomenclature: update and assessment of the recommendations of the National Society of Genetic Counselors. J Genet Couns 2008;17(5):424-33.[Pubmed]

33. Ogino S, Wilson RB. Bayesian analysis and risk assessment in genetic counseling and testing. J Mol Diagn 2004;6(1):1-9.[Pubmed]

34. Asociación para la información y la Investigación de las Enfermedades Renales Genéticas. http://www airg-e org.



Comentarios
Nombre*: Apellido*:
E-mail*:
Hospital*:
Dirección:
C.P.: País:
Comentario*:
(450 Palabras)
Código de Seguridad*:
* Campos Requeridos
Enviar
Enviar Enviar Enviar
Enviar
Órgano Oficial de la Sociedad Española de Nefrología