Información de la revista
Vol. 25. Núm. 4.Agosto 2005
Páginas 0-454
Compartir
Compartir
Descargar PDF
Más opciones de artículo
Vol. 25. Núm. 4.Agosto 2005
Páginas 0-454
Acceso a texto completo
Farmacogenética del sistema de la angiotensina en la nefropatía no diabética
Visitas
...
E. Coto, R. Marín, V. Álvarez, M. Praga, C. Fernández Andrade, M. Arias, R. Poveda, M.Vallés, J. M. Galcerán, J. Luño, F. Rivera, J. M. Campistol
Información del artículo
Texto completo
01. FARMACOGENETICA 6/2/40 05:06 Página 381 NEFROLOGÍA. Volumen 25. Número 4. 2005 ORIGINALES Farmacogenética del sistema de la angiotensina en la nefropatía no diabética E. Coto*, R. Marín*, V. Álvarez*, M. Praga**, C. Fernández Andrade***, M. Arias****, R. Poveda*****, M. Vallés******, J. M. Galcerán*******, J. Luño********, F. Rivera********* y J. M. Campistol********** *Genética Molecular. Hospital Central de Asturias e Instituto Reina Sofía de Investigación Nefrológica. **Servicios de Nefrología de los Hospitales 12 de Octubre. Madrid. ***Hospital Virgen del Rocío. Sevilla. ****Hospital de Valdecilla. Santander. *****Hospital de Bellvitge. Barcelona. ******Hospital Josep Trueta. Gerona. *******Hospital de Palamós. Gerona. ********Hospital Gregorio Marañón. Madrid. *********Hospital General de Alicante. **********Hospital Clínico y Provincial. Barcelona. RESUMEN Antecedentes: La variación genética podría contribuir a la respuesta farmacológica en los pacientes con nefropatía. Así, entre los pacientes con albuminuria diabética aquellos con el genotipo DD para el gen de la enzima convertidora de la angiotensina (ECA, polimorfismo inserción/delección, I/D) tendrían una menor respuesta renoprotectora ante los inhibidores de la ECA, comparados con los pacientes con genotipo II. Métodos: Estudiamos 71 pacientes con nefropatía crónica no diabética, de los cuales 37 habían sido tratados con losartán y 34 con amlodipino. Determinamos la tensión arterial y la proteinuria antes y después de ser tratados, y los valores medios se compararon estadísticamente. Todos los pacientes fueron genotipados para los polimorfismos I/D de la ECA, 1166 A/C del receptor de tipo 1 de la angiotensina I (AGTR1), y M235T del angiotensinógeno (AGT), y los valores medios de la reducción de la tensión sanguínea y la proteinuria fueron comparados entre los genotipos. Resultados: No hallamos diferencias en la reducción de la presión sanguínea diastólica o sistólica entre los diferentes genotipos de los polimorfismos de la ECA y el AGT, tanto para los pacientes tratados con losartán como con amlodipino. En los pacientes tratados con losartán hubo una reducción significativa de la presión diastólica entre aquellos con genotipo AGTR1-AA comparados con los heterocigotos AC (p = 0,0024). No hallamos diferencias en el nivel de reducción de la proteinuria entre los diferentes genotipos, tanto entre los tratados con losartán como con amlodipino. Conclusiones: De acuerdo con nuestros resultados, los valores medios de reducción de la presión sanguínea en los pacientes con nefropatía no diabética y tratados con losartán o amlodipino serían similares entre los diferentes genotipos de la ECA y el AGT. Aunque nuestro estudio se basó en un número reducido de Correspondencia: Dr. Eliecer Coto García Genética Molecular Hospital Central de Asturias 33006 Oviedo E-mail: eliecer.coto@sespa.princast.es 381 01. FARMACOGENETICA 6/2/40 05:06 Página 382 E. COTO y cols. pacientes, el genotipo AGTR1-AA podría estar asociado con una mayor reducción de la presión diastólica entre los pacientes tratados con losartán. Palabras clave: Nefropatía no diabética. Angiotensinógeno. Enzima conversora de la angiotensina. Receptor de la angiotensina. Polimorfismos. Farmacogenética. PHARMACOGENETICS OF ANGIOTENSIN SYSTEM IN NON DIABETIC NEPHROPATHY SUMMARY Background: Genetic variability could contribute to the response to pharmacological treatment in patients with nephropathy. In albuminuric diabetic patients the renoprotective effect of angiotensin I-converting enzyme (ACE) inhibition should be lower among homozygotes for the deletion allele (DD) compared to II-homozygotes. Methods: A total of 71 non-diabetic chronic nephropathy patients were treated with losartan (n = 37) or amlodipine (n = 34). Blood pressure and proteinuria were determined before and after the treatment, and changes in the mean values were statistically compared. Patients were genotyped for the ACE-I/D, angiotensin I receptor type 1 (AGTR1)-1166 A/C, and angiotensinogen (AGT)-M235T polymorphims, and the reduction of blood pressure and proteinuria between the different genotypes were compared. Results: The reduction in systolic or diastolic blood pressure was not found to be different between the ACE-I/D or AGT-M/T genotypes in patients treated with losartan or amlodipine. In patients treated with losartan, we found a signiticantly higher reduction of diastolic blood pressure in AGTR1-AA patients compared to AC patients (p = 0,0024). We did not find differences in proteinuria-reduction between the different genotypes in patients treated with losartan or amlodipine. Conclusions: Our data show that the effects of losartan and amlodipine on the absolute mean reduction of blood pressure and proteinuria in non-diabetic nephropathy patients are similar between the different ACE or AGT genotypes. Although based on a small number of patients, the AGTR1-AA genotype was associated with a significantly higher reduction in diastolic blood pressure among losartan-treated patients. Additional studies are necessary to refute or confirm this association. Key words: Non-diabetic nephropathy. Angiotensinogen. Angiotensin converting enzyme. Angiotensin receptor. Polymorphisms. Pharmacogenetics. INTRODUCCIÓN La farmacogenética hace referencia a la variabilidad en la respuesta farmacológica debida a factores de naturaleza genética 1. Esta variación explicaría parte de las diferencias observadas entre los pacientes tratados con un mismo fármaco, y se debería a la existencia de polimorfismos en los genes que codifican enzimas relacionados con la metabolización de esos fármacos, o en los genes que codifi382 can las proteínas de la vía fisiológica sobre las que actúa el fármaco. El polimorfismo de inserción/deleción (I/D) de la enzima conversora de la angiotensina I (ECA) está relacionado con los niveles de ECA en la sangre, teniendo los individuos con genotipo DD los niveles más altos y los II los más bajos 2. Este polimorfismo podría estar implicado en la regulación de la respuesta antiproteinúrica en el tratamiento con inhibidores de la ECA (iECAs) 3-6. Entre otros estudios publicados, se ha descrito una 01. FARMACOGENETICA 6/2/40 05:06 Página 383 ANGIOTENSINA EN NEFROPATÍA NO DIABÉTICA menor respuesta antiproteinúrica en los pacientes diabéticos con los genotipos DD e ID comparados con los II 5, 6. El efecto renoprotector ha sido también observado entre pacientes con nefropatía no diabética 4. Además de la variación en el gen de la ECA, los polimorfismos en los genes del angiotensinógeno (AGT) y del receptor de tipo 1 de la angiotensin II (AGTR1) podrían también contribuir a modular la respuesta a varios fármacos que actúan sobre el sistema renina-angiotensina, como los iECAs y los antagonistas del receptor. En este estudio evaluamos el papel de tres polimorfismos en los genes ECA, AGT, y AGTR1 en la capacidad renoprotectiva del losartán (un antagonista del receptor) y el amlodipino (un agente que bloquea los canales de calcio) entre pacientes con nefropatía no diabética. MÉTODOS Diseño del estudio y pacientes Estudiamos 71 pacientes, mayores de 18 años, con nefropatía no diabética y que cumplían los siguientes requisitos: una nefropatía crónica con proteinuria de 24 horas > 1,5 g, una presión sanguínea sistólica (PS) entre 140 y 170 mm Hg y/o una presión diastólica (PD) entre 90 y 105 mm Hg, y una creatinina sérica menor de 2,5 mg/dl. Ninguno de los pacientes era diabético, recibía más de un fármaco antihipertensivo, o había sufrido episodios cardiovasculares. Todos estos pacientes formaban parte de un estudio más amplio en el que se había evaluado el papel del losartán y el amlodipino en 97 pacientes 7. En el estudio farmacogenético no se pudieron incluir 26 pacientes que rehusaron participar (17 casos) o de los que no fue posible obtener ADN (9 casos). Los 71 pacientes se sometieron a un período de ocho semanas en el que no recibieron ningún tratamiento antihipertensivo, que fue sustituido por placebo. Tras completar este período de «lavado», 37 pacientes fueron tratados con losartán (50 mg) y 34 con amlodipino (5 mg), una toma al día. Después de cuatro semanas de tratamiento, se añadió hidroclorotiazida (HCTZ; 12,5 mg en una sola toma diaria) si la presión sanguínea no se mantenía por debajo de los valores deseados (PS > 150 mm Hg y/o PD > 90 mm Hg). Tras ocho semanas (semana 8) la dosis diaria de losartán o amlodipino se subió a 100 mg y 10 mg, respectivamente (una toma al día) si la presión sanguínea se mantenía por encima de los valores deseados. Si tras otras cuatro semanas de tratamiento (semana 12) estos valores se mantenían por encima de lo deseado, se incrementó la dosis de HCTZ a 25 mg diarios 7. Los valores de la PD, PS y proteinuria se midieron en el último día de la semana 16 de tratamiento. Análisis genético Los polimorfismos ACE I/D, AGT M235T (un cambio C/T en el codón 235 del gen AGT), y ATR1 1166 A/C fueron analizados según procedimientos descritos previamente 8, 9. En el caso del polimorfismo I/D de la ECA amplificamos mediante la reacción en cadena de la polimerasa (PCR) un fragmento de 490 bases (alelo I) o de 190 bases (alelo D). La mezcla de reacción contenía los cebadores CTGGAGACCACTCCCATCCTTTCT y GATGTGGCCATCACATTCGTCAGAT, y tras 32 ciclos de amplificación de 95 °C-30 s, 58 °C-45s y 90s-72 °C 10 µl de cada reacción se sometieron a electroforesis en un gel de agarosa al 2% agarose para visualizar los alelos y determinar el genotipo de cada paciente (DD, ID o II). Debido a que el alelo de inserción puede amplificar de forma menos eficaz que el alelo de deleción, algunos individuos ID podían ser genotipados erróneamente como DD. Por ello, cada genotipo DD fue confirmado mediante la verificación de la ausencia de producto de amplificación en una PCR conteniendo un cebador específico del alelo I, siguiendo un protocolo descrito previamente 10. Para determinar los genotipos del polimorfismo del AGT, el ADN de cada paciente fue amplificado con los cebadores GATGGCACAAGGTCCTG y CAGGGTGCTGTCCACACTGGCTCGC (cebamiento a 62 °C). Tras 32 ciclos de PCR cada reacción fue digerida con el enzima de restricción BstUI y sometida a una electroforesis en geles de agarosa al 3%. Los dos alelos se visualizaron como bandas de 303 bases (235 M) o 279 bases (235 T). El polimorfismo 1166 A/C en la región 3' no traducida del gen AGTR1 fue analizado siguiendo un protocolo descrito previamente, en el que el ADN se amplificó mediante la pareja de cebadores GCAGCACTTCACTACCAAATGAT y TGTTCTTCGAGCAGCCGT (cebamiento a 58 °C) 8. Cada reacción fue a continuación digerida con el enzima de restricción Bcl I, y tras electroforesis en geles de agarosa al 3% los alelos fueron visualizados como bandas de 176 bases (1166 C) o 156 bases (1166 A). Análisis estadístico Comparamos los valores medios de la reducción en la PS, la PD y la proteinuria entre los diferentes 383 01. FARMACOGENETICA 6/2/40 05:06 Página 384 E. COTO y cols. genotipos de cada polimorfismo mediante el test estadístico de la t de Student. Los valores del intervalo de confianza al 95% para la reducción media entre los genotipos fueron también calculados. Para los cálculos estadísticos empleamos un programa estadístico para Windows. RESULTADOS En la tabla I resumimos las principales características de los pacientes con nefropatía no diabética tratados con losartán (n = 37) o amlodipino (n = 34). Observamos una reducción significativa de la presión sanguínea con ambos tratamientos, sin que hubiese diferencias en la reducción de la PS o la PD entre el losartán y el amlodipino. Sin embargo, la reducción en la proteinuria fue significativamente mayor entre los pacientes tratados con losartán (p = 0,032). Comparamos la reducción en la PS, la PD y la proteinuria según los genotipos de los tres polimorfismos analizados. Estos resultados se resumen en las tablas II, III y IV. No hallamos diferencias significativas entre la reducción de los tres valores según los genotipos de la ECA y el AGT, tanto en los tratados con losartán como con amlodipino. Entre los pacientes tratados con losartán la reducción en la PS y la PD fue mayor en aquellos con un genotipo AGTR1-AA que en los AC (ningún paciente tenía el genotipo homocigoto CC), aunque sólo la reducción en la diastólica fue significativamente mayor en los AA (p = 0,0024; tabla IV). DISCUSIÓN El papel de los factores genéticos heredados en las diferencias entre las personas en la respuesta a los tratamientos farmacológicos es un hecho constatado, y ha dado lugar al desarrollo de la farmacogenética. Actualmente conocemos la mayoría de los genes del genoma humano, y se han identificado muchos que codifican proteínas implicadas en la metabolización (activación y eliminación) de los fármacos. Otros genes codifican los péptidos sobre los que actúa el principio activo del fármaco en cuestión. La variación en estos y otros genes podría afectar al nivel de expresión de la proteína, pero en ambos casos se vería implicada la capacidad de respuesta del individuo ante el tratamiento. Ante esta variabilidad, debido a su genotipo para los polimorfismos de estos genes algunos pacientes pueden requerir dosis de un Tabla I. Principales características de los pacientes con nefropatía no diabética tratados con losartán (37 casos) y amlodipino (34 casos). Las cifras basales y finales de las presiones diastólicas (PD) y sistólicas (PS), y de la proteinuria corresponden a los valores medios. Entre paréntesis, además de los % se indican los valores de los intervalos de confianza al 95% (95% CI) Losartán (n = 37) Hombres/Mujeres Edad media ± SD Tipos de glomerulonefritis* IgA GNM FSG NE Otros PS media mmHg (95% CI) Basal Final PD media mmHg (95% CI) Basal Final 26/11 48 ± 14 12 (32%) 4 (12%) 6 (16%) 3 (8%) 12 (32%) A mlodipino (n = 34) 26/8 4 6 ± 15 8 (24%) 9 (26%) 4 (12%) 1 (3%) 12 (35%) Tabla II. Reducción en las PS y PD y en la proteinuria en pacientes tratados con losartán y amlodipino, según los genotipos de la ECA. Todos los valores se representan como reducciones medias (entre paréntesis, los valores del intervalo de confianza al 95%) ECA Reducción media PS (mm Hg) Los Am PD (mm Hg) Los Am Proteinuria (mg/24 h) (Final/Basal) % II (n = 6) 15 (3,27) 7 (-2, 16) 8 (0, 16) 5 (-1, 11) ID (n = 21) 20 (13,26) 11 (5, 17) 9 (6, 14) 3 (-1, 6) 51 (38, 68) DD (n = 10) 14 (4,23) 14 (7, 21) 11 (3, 16) 9 (4, 13) 53 (35, 81) DD vs II + ID -5 (-16,6) P = 0,36 4 (-4, 12) P = 0,3514 0,15 (-7,7) P = 0,96 5 (0,10) P = 0,0589 95 (58, 157) P = 0,85 82 (58, 115) P = 0,24 148 (143, 152) 148 (144, 156) 130 (125, 135) 137 (132, 141) P = 0,0708 93 (90, 96) 83 (80, 86) 91 (88, 93) 85 (83, 88) P = 0,2762 Proteinuria media mg/24 h (95% CI) Basal 3.361 (2.704, 4.180) 2689 (2.056, 3.516) Final 1.842 (1.452, 2.339) 2.732 (2.063, 3.619) P = 0,0324 *IgA = IgA-nefropatía; GNM = glomerulonefritis membranosa; FSG = glomeruloesclerosis focal segmental; NE = nefroesclerosis. Los 75 (43, 129) Am 100 (67, 148) 113 (88, 143) 89 (67, 118) Los: losartán; Am: amlodipino. 384 01. FARMACOGENETICA 6/2/40 05:06 Página 385 ANGIOTENSINA EN NEFROPATÍA NO DIABÉTICA Tabla III. Reducción en las PS y PD y en la proteinuria en pacientes tratados con losartán y amlodipino, según los genotipos del angiotensinógeno. Todos los valores se representan como reducciones medias (entre paréntesis, los valores del intervalo de confianza al 95%) AGT Reducción media PS (mm Hg) Los Am PD (mm Hg) Los Am Proteinuria (mg/24 h) (Final/Basal) Los MM (n = 11) MT (n = 22) TT (n = 4) 18 (3, 33) MM vs MT + TT TT vs MM + MT 19 (11, 28) 16 (10, 22) 13 (7, 20) 9 (3, 14) 8 (4, 12) 44 (30, 63) 14 (8, 21) 10 (6, 14) 7 (3, 11) 65 (49,86) Am 113 (85, 152) 92 (70, 121) -3 (-14, 7) P = 0,53 0,55 (-15, 16) P = 0,94 -3 (-11, 6) P = 0,48 5 (-2, 12) -9 (-17, 1) P = 0,063 1 (-6, 7) P = 0,80 9 (0, 18) -0,58 (-11, 9) P = 0,90 -4 (-10, 1) P = 0,11 -0,3 (-4,6, 4) -8 (-13, -3) P = 0,053 76 (38, 152) P = 0,43 43 (23, 81) 138 (88, 216) P = 0,15 100 (70, 145) P = 0,98 102 (75, 139) 85 (60, 121) P = 0,35 Los : losartán; Am: amlodipino. Tabla IV. Reducción en las PS y PD y en la proteinuria en pacientes tratados con losartán y amlodipino, según los genotipos del receptor de tipo 1 de la angiotensina II. Todos los valores se representan como reducciones medias (entre paréntesis, los valores del intervalo de confianza al 95%) AGTR1 Reducción media PS (mm Hg) Los Am PD (mm Hg) Los Am Proteinuria (mg/24 h) (Final/Basal) % Los Am AC (n = 15) 13 (5, 20) 9 (2, 16) 4 (0, 8) 2 (-2, 7) 54 (39, 76) -6 (-41, 21) AA (n = 22) 20 (14, 26) 13 (8, 19) 13 (10, 17) 8 (4, 11) 56 (42, 75) 6 (-16, 24) AA vs AC 7 (-18, 2) P = 0,13 4 (5, 14) P = 0,51 9 (3, 15) P = 0,0024 6 (4, 17) P = 0,13 104 (65, 162) P = 0,88 88 (-33, 41) P = 0,79 Los: losartán; Am: Amlodipino. fármaco más elevadas que otros para conseguir el mismo efecto, y en casos extremos el fármaco puede ser totalmente ineficaz en unas personas o tener efectos tóxicos a dosis bajas en otras 1. El losartán se une al receptor de tipo 1 de la angiotensina II, reduciendo la respuesta vasopresora de la angiotensina II al competir con ella. El gen AGTR1 es polimórfico, y algunos de estos polimorfismos han sido relacionados con el riesgo de desarrollar enfermedades cardiovasculares y renales11-15. Por su parte, la angiotensina II se forma tras la hidrólisis del precursos angiotensinógeno por la enzima conversora e la angiotensina, ambos codificados por genes también polimórficos. Los polimorfismos en los genes AGT y ECA han sido relacionados con los niveles sanguíneos de la ECA, y podrían contribuir de forma significativa al riesgo de sufrir enfermedades cardiovasculares y renales, o modular su progresión una vez iniciado el proceso patológico 11, 16-20. Dado que los antagonistas del AGTR1 actuán sobre un componente del sistema renina-angiotensina, los polimorfismos de los genes que codifican proteínas de esta vía fisiológica podrían contribuir a modular la respuesta al losartán. Nuestros datos con pacientes con nefropatía no diabética tratados con losartán mostraron una reducción significativa de la presión arterial y la albuminuria, pero esta reducción fue similar entre los diferentes genotipos de la ECA y el AGT. En cuanto al polimorfismo del AGTR1 observamos una mayor reducción de la presión diastólica entre los pacientes con genotipo 1166 AA, comparados con los de genotipo AC. Sin embargo, aunque la diferencia fue estadísticamente significativa esta comparación se basó en un número reducido de pacientes (22 AA y 15 AC), y ningún paciente tenía el genotipo raro CC. Por tanto, otros estudios con series más grandes de pacientes son necesarios para confirmar o refutar la relación entre este polimorfismo y la respuesta al losartán en lanefropatía no diabética. La ausencia de una asociación significativa entre la respuesta al losartán y el polimorfismo I/D de la ECA está de acuerdo con los resultados descritos por Andersen y cols. 21. Estos autores analizaron pacientes hipertensos con nefropatía por diabetes de tipo I, 28 homocigotos II y 28 homocigotos DD, y no hallaron diferencias en la reducción de la presión sanguínea o la proteinuria entre ambos genotipos. Sin embargo, la reducción en la albuminuria entre los pacientes tratados con un inhibidor de la ECA podría estar influida por el genotipo, y los pacientes II tendrían una reducción signficativamente mayor que los DD 5, 6. Como conclusiones, no hemos hallado diferencias significativas entre la reducción media de la presión arterial y la proteinuria entre los diferentes genotipos de la ECA o el AGT, en pacientes con nefropatía no diabética tratados con losartán o con amlodipino. Hallamos una reducción significativa de la 385 01. FARMACOGENETICA 6/2/40 05:06 Página 386 E. COTO y cols. presión diastólica entre los pacientes con fenotipo AGTR1-AA tratados con losartán. Sin embargo, estos resultados se basaron en un número reducido de pacientes y deben por tanto ser tomados con cautela. Más estudios con muestras más grandes son necesarios para confirmar o refutar la relación entre este polimorfismo y la respuesta al losartán en la nefropatía no diabética, antes de que la determinación del genotipo pudiera ser aplicado a la predicción de la respuesta farmacológica en estos pacientes. AGRADECIMIENTOS Los autores desean expresar su agradecimiento a los pacientes que participaron en el estudio, a M. A. Sánchez Zamorano y a Merck Sharp & Dohme Spain por el apoyo prestado, y a E. Sobreviela por supervisar los análisis estadísticos. En la realización de este trabajo se han empleado recursos aportados por el proyecto de investigación FIS 01/0356. BIBLIOGRAFÍA 1. Roses AD: Pharmacogenetics. Hum Mol Genet 10: 22612267, 2001. 2. Rigat B, Hubert C, Alhenc-Gelas F y cols.: An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest 86: 1343-1346, 1990. 3. Van Essen GG, Rensma PL, De Zeeuw D y cols.: Association between angiotensin-converting-enzyme gene polymorphism and failure of renoprotective therapy. Lancet 347: 94-95, 1996. 4. Yoshida H, Mitarai T , Kawamura T y cols.: Role of the deletion polymorphism of the angiotensin converting enzyme gene tin the progression and therapeutica responsiveness of IgA nephropathy. J Clin Invest 96: 2162-2169, 1995. 5. Parving HH, Jacobsen P, Tarnow L y cols.: Effect of deletion polymorphism of angiotensin converting enzyme gene on progression of diabetic nephropathy during inhibition of angiotensin converting enzyme: observational follow up study. BMJ 313: 591-594, 1996. 6. Penno G, Chatuverdi N, Talmud PJ y cols.: The Euclid Study Group: effect of angiotensin converting enzyme (ACE) gene polymorphism on progression of renal disease and the influence of ACE-inhibition in IDDM patients. Findings from the Euclid randomized controlled trial. Diabetes 47: 15071511, 1998. 7. Praga M, Fernández Andrade C, Luño J, Arias M, Poveda R, Mora J, Prat MV, Rivera F, Galcerán JM, Ara JM, Aguirre R, 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. Bernis C, Marín R, Campistol JM: Antiproteinuric efficacy of losartan in comparison with amlodipine in nondiabetic proteinuric renal diseases: a double blind, randomized clinical trial. Nephrol Dial Transplant 18: 1806-1813, 2003. Álvarez R, Reguero JR, Batalla A y cols.: Angiotensin-converting enzyme and angiotensin II receptor 1 polymorphisms: association with early coronary disease. Cardiovasc Res 40: 375-379, 1998. Coto E, Rodrigo L, Álvarez R y cols.: Variation in the angiotensin-converting enzyme and endothelial nitric oxide synthase genes is associated with the risk of esophageal varices among patients with alcoholic cirrhosis. J Cardiovasc Pharmacol 38: 833-829, 2001. Shanmugan V, Sell KW, Saha BK: Mistyping ACE heterozygotes. PCR Methods Appl 3: 120-121, 1993. Van Ittersum J, De Man AM, Thijsen S y cols.: Genetic polymorphisms of the renin-angiotensin system and complications of insulin-dependent diabetes mellitus. Nephrol Dial Transplant 15: 1000-1007, 2000. Duncan JA, Scholey JW, Miller JA: Angiotensin II type 1 receptor gene polymorphisms in humans: physiology and pathophysiology of the genotypes. Curr Opin Nephrol Hypertens 10: 111-116, 2001. Boonstra A, De Zeeuw D, De Jong PE, Navis G: Role of genetic variability in the renin-angiotensin system in diabetic and non diabetic renal disease. Semin Nephrol 21: 580-592, 2001. Bonnardeaux A, Davies E, Jeunemaitre X y cols.: Angiotensin II type 1 receptor gene polymorphisms in human essential hypertension. Hypertension 24: 63-69, 1994. Cambien F, Poirier O, Lecerf L y cols.: Deletion polymorphism in the gene for angiotensin-convertign enzyme is apotent risk factor for myocardial infarction. Nature 359: 641644, 1992. Olivieri O, Grazioli S, Pizzolo F y cols.: Different impact of deletion polymorphism of gene on the risk of renal and coronary artery disease. J Hypertens 20: 37-43, 2002. Gumprecht J, Zychma MJ, Grzeszczak W, Zukowska-Szczechowska E: Angiotensin I-converting enzyme gene insertiondeletion and angiotensinogen M235T polymorphism: risk of chronic renal failure. End-Stage Renal Disease Group. Kidney Int 58: 513-519, 2000. Pei Y, Scholey J, Thai K, Suzuki M, Cattran D: Association of angiotensinogen gene T235 variant with progression of immunoglobulin A nephropathy in Caucasian patients. J Clin Invest 100: 814-820, 1997. Batalla A, Álvarez R, Reguero JR y cols.: Synergistic effect between apolipoprotein E and angiotensinogen gene polymorphisms in the risk for early myocardial infarction. Clin Chem 46: 1910-1915, 2000. González P, Álvarez R, Álvarez V, Coto E: Genetic variation and progresion of renal failure. Nefrología 23 (Supl. 4): 3641, 2003. Andersen S, Tarnow L, Cambien F y cols.: Renoprotective effects of losartan in diabetic nephropathy: interaction with ACE insertion/deletion genotype? Kidney Int 62: 192-198, 2002. 386
Idiomas
Nefrología

Suscríbase a la newsletter

Opciones de artículo
Herramientas
es en

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?