Información de la revista
Vol. 22. Núm. 6.Diciembre 2002
Páginas 0-589
Compartir
Compartir
Más opciones de artículo
Vol. 22. Núm. 6.Diciembre 2002
Páginas 0-589
Acceso a texto completo
Remisión de enfermedad severa por citomegalovirus y enfermedad linfoproliferativa post-trasplante en un receptor de trasplante renal trasterapia con ganciclovir y cambio en la medicación inmunosupresora
Visitas
...
E. GÓMEZ , J. ALVAREZ , S. MELÓN , M. F. FRESCO , L. TRICAS , R. NAVASCUÉS , M. DE OÑA , M. HERREROS
Información del artículo
Texto completo
Estadísticas
Texto completo
NEFROLOGÍA. Vol. XXII. Número 6. 2002 Remisión de enfermedad severa por citomegalovirus y enfermedad linfoproliferativa post-trasplante en un receptor de trasplante renal tras terapia con ganciclovir y cambio en la medicación inmunosupresora E. Gómez1, S. Melón2, M. F. Fresno3, L. Tricas4, R. Navascués1, M. de Oña2, M. Herreros3 y J. Álvarez Grande1, MD Servicios de 1Nefrología, 2Microbiología, 3Patología e 4Inmunología. Hospital Central de Asturias. Oviedo. RESUMEN Se describe el caso de un receptor de trasplante renal con sobreinmunosupresión inducida por la interacción de tacrolimus y fluconazol que desarrolló dos enfermedades severas producidas por dos virus diferentes del grupo herpes: enfermedad por citomegalovirus (CMV) y enfermedad linfoproliferativa post-trasplante (ELPT). La detección del genoma del virus de Epstein-Barr (VEB) en sangre periférica precede al diagnóstico de ELPT. Ambas enfermedades remitieron con el cambio del régimen inmunosupresor y tratamiento con ganciclovir. Debido a que la infección por CMV es un factor de riesgo para desarrollar ELPT y a que las manifestaciones clínicas y endoscópicas de ambas enfermedades pueden confundirse, en los pacientes con enfermedad por CMV se debe descartar la presencia de una ELPT concomitante, sobre todo si estos pacientes son seronegativos para el virus de Epstein-Barr. La detección del genoma del VEB en sangre periférica puede ser de gran ayuda en el diagnóstico precoz de ELPT en estos pacientes. Palabras clave: Trasplante renal. Ganciclovir. Tacrolimus. ELPT. CMV REMISSION OF SEVERE DISEASE INDUCED BY CMV AND LYMPHOPROLIFERATIVE POSTTRANSPLANT DISEASE AFTER CHANGING THE IMMUNOSUPPRESSION REGIME SUMMARY We describe a renal transplant recipient, with overimmunosuppression induced by the interaction of tacrolimus and fluconazole, who developed two severe diRecibido: 14-V-2002. En versión definitiva: 9-IX-2002. Aceptado: 9-IX-2002. Correspondencia: Dr. Ernesto Gómez Huertas Servicio de Nefrología Hospital Central de Asturias Celestino Villamil, s/n. 33006 Oviedo E-mail: egomezh@hcas.insalud.es 574 REMISIÓN DE ENFERMEDAD POR CMV Y ELPT seases produced by two different viruses of the herpes group (cytomegalovirus [CMV] disease and posttransplant lymphoproliferative [PTLD] disease EBV-related). Detection of Epstein-Barr virus (EBV) DNA in the blood preceded the histological diagnosis of PTLD. Both diseases improved after changes in the immunosuppressive regime and treatment with ganciclovir. Because CMV infection is a risk factor in developing PTLD, and the clinical and endoscopic manifestations of both diseases could be become confused, PTLD should be excluded in EBV seronegative patients that develop CMV disease. The detection of the EBV genome in blood could help in the early diagnosis of PTLD in these patients. Key words: Renal transplant. PTLD. CMV. Ganciclovir. PCR. Tacrolimus. INTRODUCCIÓN El citomegalovirus (CMV) es el patógeno viral que produce más morbi-mortalidad en los receptores de órganos 1. Por otra parte, el virus de Epstein-Barr (VEB) raramente produce patología en estos pacientes, pero generalmente se asocia con desórdenes linfoproliferativos post-trasplante (ELPT) 2. El mayor riesgo para padecer ambas enfermedades es el estado serológico de donante y receptor (donante positivo, receptor negativo) y el estado neto de inmunosupresión 3-5. Este último está influenciado sobre todo por la intensidad de la inmunosupresión inducida por las drogas anti-rechazo. Se describe el caso de un paciente que desarrolló dos enfermedades severas producidas por dos diferentes virus del grupo herpes: enfermedad por CMV y ELPT, que remitieron con cambios en la inmunosupresión y tratamiento con ganciclovir. Además, se estudia el diagnóstico molecular de ambas enfermedades y la utilidad de la monitorización del genoma del VEB en sangre periférica en el diagnóstico precoz de la ELPT. CASO CLÍNICO Un paciente varón de 60 años de edad con fallo renal crónico de origen no filiado recibió un trasplante renal de cadáver el 16 de mayo de 1997. La serología pre-trasplante mostró que el receptor era CMV IgG positivo, varicela-zoster virus (VVZ) IgG positivo, herpes simplex (VHS) IgG positivo, pero VEB-VCA y anti-EBNA IgG negativo. El donante fue una mujer de 43 años sin antecedentes patológicos. La serología pre-mortem mostró IgG positivo frente a CMV, VVZ, VHS y VEB. El régimen inmunosupresor incluyó prednisona y tacrolimus. El 11 de junio el paciente recibió 3 bolos IV de 500 mg de 6-methil-prednisolona por sospecha clínica de crisis de rechazo agudo. En el 53rd día posttrasplante se detectó CMV en polimorfonucleares de sangre periférica (LPNs), tanto por antigenemia CMV (CMV-AG) como por reacción en cadena de la polimerasa (CMV-PCR). El cuadro clínico consistió en malestar general, pérdida de peso, febrícula y leucopenia moderada. La inmunosupresión se disminuyó, la febrícula y la leucopenia desaparecieron a los pocos días, pero persistió el malestar general y la pérdida de peso (fig. 1A). El 1 de agosto, 77 días después del trasplante, aparecieron úlceras blancuzcas en la boca, por lo que se administró fluconazol oral (200 mg/24 horas). Tres días después, los niveles de tacrolimus aumentaron de 13 ng/ml a > 30 ng/ml, por lo que se suspendió el fluconazol y se reemplazó el tacrolimus por ciclosporina a dosis bajas (niveles valle entre 240 y 60 ng/ml). La función renal no se modificó en ningún momento. En los días siguientes, el paciente desarrolló fiebre y disnea y el contaje de CMV-AG aumentó a 450 cels/105 PMNs positivas (fig. 1A). La exploración física mostró hepato-esplenomegalia, pero no se encontraron adenopatías a ningún nivel. Los datos de laboratorio fueron los siguientes: hemoglobina, 7,6 g/dL, leucocitos 2,600/µL (70% neutrófilos, 22% linfocitos, 8% monocitos), plaquetas 163,000/µL, creatinina sérica 2,4 mg/dL, transaminasa glutámico pirúvica 11 IU/L, pO2 (con el paciente respirando aire) 73 mmHg, pCO2 29 mmHg, proteinuria 1,35 g/día, sedimento urinario normal. Cultivos de sangre y orina negativos. Una radiografía de tórax fue normal. Una tomografía computerizada del tórax, abdomen y cabeza no mostró anormalidades. El 12 de agosto se comenzó a administrar ganciclovir intravenoso (Cymevene, Sintex Corp., Palo Alto, Caliph., USA) y gammaglobulina hiperinmune (Cytotec, Biotest Pharma, Frankfurt, Germany). El día 97 después del trasplante apareció hemorragia digestiva intensa. Una gastroduodenoscopia mostró 5 úlceras gástricas de bordes prominentes e irregulares. El estudio microscópico mostró un infiltrado difuso y polimórfico de células de naturaleza linfoide, células plasmáticas y polimorfonucleares 575 E. GÓMEZ y cols. A 800 CMV-AG+ cels/105 PBLS 700 600 500 400 300 200 100 0 Tacrolimus CMV-AG+ Fluconazol Fiebre alta Leucopenia Gastroscopia Cytotec® Ganciclovir 50 40 Niveles de tacrólimus (ng/ml) Hemorragia gástrica 30 20 10 0 0 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 Días Post-trasplante B EBV-PCR CMV-PCR 500 CMV-AG+ cels/105 PBLs Ganciclovir 400 PTLD 300 200 100 0 0 10 20 30 40 50 60 70 80 90 100 110 120 130 140 150 160 170 180 190 200 Días Post-trasplante CMV+ VEB+ CMV+ VEB+ CMV+ VEB+ Fig. 1.--Evolución clínica del paciente. A) Elevación de los niveles de tacrolimus y CMV-AG siguiendo a la administración de fluconazol, desarrollo de enfermedad por CMV y remisión con sustitución de tacrolimus por ciclosporina y tratamiento con ganciclovir; B) detección de DNA de CMV y EBV. CMV+ y EBV+ indican detección del genoma de CMV y EBV en tejido gástrico, respectivamente. neutrófilos, y frecuentes células linfoides activadas con características inmunobláticas, algunas de ellas binucleares. Todas las muestras examinadas mostraban áreas irregulares de necrosis coagulativa. También se observaron lesiones linfoepiteliales. Un estudio inmmunohistoquímico mostró una población linfoide B con un alto grado de proliferación (45%), moderadamente positiva para bcl-2 y frecuentemente positiva para LMP-1 en las células de tipo inmunoblástico, y una población asociada de tipo linfoide B positiva para CD45RO, CD20 y Ki67 (fig. 2A). No se detectó Helycobacter pilorii. Los estudios genéticos moleculares mostraron reagrupamiento clonal de genes de cadenas pesadas de inmunoglobulinas (fig. 3). La PCR tisular fue negativa para VHS-1 y VHS-2, pero positiva para CMV y VEB (fig. 4). Los 576 Fig. 2.--Examen histológico del tejido gástrico. A) primera biopsia realizada a los 97 días del trasplante. Se observa un infiltrado polimorfico intenso de la lámina propia con disrupción de las glándulas (H&E magnificación × 200). Insertada: positividad inmunohistoquímica en relación con la EBV Latent Membrane Protein (LPM-1) (magnificación × 400); B) Mucosa gástrica 10 días después de la primera biopsia y 20 después de la sustitución de tacrolimus por ciclosporina y comienzo con tratamiento con ganciclovir: aspecto normal (H&E magnificación × 400). cultivos en shel-vial para VHS-1, VHS-2 y CMV fueron todos negativos. Los cultivos para hongos también fueron negativos. Después de 3 semanas de terapia antiviral, el paciente mejoró, la fiebre, la anemia y los síntomas digestivos desaparecieron progresivamente. Una segunda endoscopia realizada a los 10 días de la primera mostró únicamente 3 pequeñas lesiones ulceradas en el antro gástrico. La histología experimentó un cambio radical respecto a la previa, con preservación de la arquitectura glandular y ausencia de infiltrado linfoide polimórfico (fig. 2B), pero el genoma del CMV y del EBV continuaron detectándose REMISIÓN DE ENFERMEDAD POR CMV Y ELPT 12 3456M78 9 M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 bp 343 110 88 bp Fig. 3.--Demostración de clonalidad. El DNA amplificado de mucosa gástrica conservado en parafina gástrica muestra una sola banda de aproximadamente 88 bp (Kodak Digital Science 1D computer program) después de aplicar «seminested» PCR. Las líneas 1 y 2 son los controles negativo y positivo del gen HFE; la línea 3 muestra DNA integro del paciente; las líneas 4, 5 y 6 muestran la primera ronda de amplificación (control negativo, control positivo y paciente negativo respectivamente); la línea M es el control de peso de 50 bp DNA; líneas 7, 8 y 9 muestran el segundo pase (control negativo, control positivo y paciente positivo respectivamente). Fig. 4.--Electroforesis en gel de agarosa de muestras amplificadas de DNA de VEB y CMV del paciente. Las flechas indican 209 (abajo) y 300 (arriba) bases de pares de EBNA-1 y glicoproteína B de VEB y CMV respectivamente. La línea M muestra el control de pesos de 100 bp; líneas 1, 11 y 12 son muestras de sangre negativas; líneas 3 y 6 son muestras de sangre positivas para ambos virus; líneas 2, 7, 8 y 10 son muestras de sangre positivas para CMV y negativas para VEB; líneas 4 y 5 son muestras positivas para EBV y CMV de lesiones ulceradas de la mucosa gástrica; líneas 13, 14 y 15 son control negativo para ambos virus, control VEB positivo y control positivo CMV. una nueva endoscopia digestiva realizados en enero de 2002 han sido normales. MÉTODOS en el tejido gástrico y en sangre periférica, por lo que el ganciclovir fue mantenido durante 6 semanas y la gammaglobulina hiperinmune durante 9 dosis. Una tercera endoscopia realizada un mes después de la segunda mostró una mucosa gástrica completamente normal. La histología también fue normal. Se realizó un análisis retrospectivo de PCR de VEB en muestras de sangre congeladas a ­70° C. El examen de las mismas mostró detección del genoma DNA del VEB en sangre en los días previos a la hemorragia digestiva. La PCR se negativizó alrededor de 2 semanas del comienzo del tratamiento con ganciclovir. Sin embargo, la CMV-PCR y bajos contajes de CMV-AG aparecieron de nuevo después del final del tratamiento, para desaparecer definitivamente después (fig. 1B). La PCR del donante fue negativa para el CMV y el VEB. Hasta la fecha, 3 años después del comienzo de la enfermedad, el paciente permanece asintomático, con una creatinina sérica de 1,4 mg/dL. La inmunosupresión de mantenimiento consiste en prednisona y ciclosporina. Una TAC toraco-abdominal y Métodos virológicos Se recolectaron muestras de sangre semanalmente que se procesaron para PCR junto con las 3 biopsias gástricas. Las muestras se centrifugaron a 6.000 rpm durante 5 minutos, se removió el sobrenadante y se añadieron 100 µl de solución de lisis (10 mM Tris-HCl pH8,3, 50 mM KCl, 0,5% Nonidet-40, 0,5% Tween 20, y 10 µg proteinasa K). La mezcla se incubó durante 45 minutos a 56° C y luego 10 minutos a 96 °C para inactivar la proteinasa K (Boehringer Mannheim, GmbH Biochemica Mannheim, Germany). La cantidad de DNA en las muestras se ajustó a una concentración final de 0,1 mg/ml. Se realizó una PCR-«nested» múltiple para CMV y VEB, y otra para VHS-1, VHS-2 y VVZ 6. Brevemente, una mezcla conteniendo 10 mM Tris-HCl pH 8.3, 50 mM KCl, 1,5 mM MgCl2, 1 U de Taq (Gibco, Grand Island, NY), 50 µM de cada dNTP (Promega) y 0,5 pmol de cada «primer» de CMV y VEB (tabla I) fueron preparados para dar un total de 40 µl. La mez577 E. GÓMEZ y cols. Tabla I. «Primers» usados para la detección de DNA viral CMV Glicoproteína B (322 bp) (300 bp) EBNA-1 gen (297 bp) (209 bp) P1.- (1821-1837) 5'- TGA-GGA-ATG-TCA-GCT-TC-3' P2.- (2130-2146) 5'-TCA-TGA-GGT-CGT-CCA-GA-3' (EB3).- (109332-109351) 5'-AAG-GAG-GGT-GGT-TTG-GAA-AG-3' (EB4).- (109609-109628) 5'- AGA-CAA-TGG-ACT-CCC-TTA-GC-3' P3.- (1838-1856) 5'-CCA-GCC-TCA-AGA-TCT-TCA-T-3' P4.- (2119-2138) 5'-TCG-TCC-AGA-CCC-TTG-AGG-TA-3' (EB1).- (109353-109372) 5'-ATC-GTG-GTC-AAG-GAG-GTT-CC-3' (EB 2).- (109542-109561) 5'-ACT-CAA-TGG-TGT-AAG-ACG-AC-3' EBV cla se cubrió con 30 µl de aceite mineral, y se añadió 10 µl de la muestra. La amplificación comprendió 22 ciclos de desnaturalización a 95° C durante 30 segundos, anillamiento a 55° C durante 30 segundos y elongación a 72° C durante 1 minuto seguido por un paso final de extensión de 10 minutos a 72° C. Después de la primera ronda de amplificación, se añadió 1 U Taq y 25 pmol de «primer» de cada virus, y se realizó otra ronda de 35 ciclos de desnaturalización a 95° C durante 30 segundos, anillamiento a 55° C durante 30 segundos, y elongación a 72° C durante 1 minuto seguido por una extensión final a 72° C durante otros 10 minutos. Diez µl del producto obtenido se procesaron para electroforesis en un gel de agarosa al 2% en Tris-borato/EDTA conteniendo 0,5 µg/ml de bromuro de ethidium y fueron examinados con luz UV. Durante todo el proceso se adoptaron las precauciones estándar para evitar la contaminación cruzada. La PCR múltiple para VHS-1, VHS-2 y VVZ se realizó en las mismas condiciones, cambiando la temperatura de anillamiento a 52° C en el primer ciclo y a 61° C en el segundo. La antigenemia CMV se determinó por el método descrito previamente 7. Métodos inmunohistoquímicos Los especímenes de las biopsias gástricas fueron procesadas por métodos convencionales con bloques de parafina fijados con formalina. La inmunohistoquímica del material fue procesado con un sistema ABC para anticuerpos monoclonales CD20, CD30, CD45RO, citoqueratina de bajo peso molecular (CAM5,2), bcl-2, Ki-67, CMV y LMP-1 (Latent Membrane Protein of EBV) (Dako, Carpentaria, Calif,. USA). Detección de monoclonalidad por PCR Se realizó extracción de DNA de secciones de tejido gástrico en parafina como se ha descrito pre578 viamente 8. Para evaluar la integridad del DNA obtenido se utilizaron «primers» derivados del gen HFE 9. Para detectar el reordenamiento de los genes de las cadenas pesadas de la inmunoglobulina humana se realizó una PCR «seminested» para amplificar la región V-D-J. Los «primers» usados han sido descritos previamente10 y sus secuencias son las siguientes: para la tercera porción de la región V: 5´CTGTCGACACGGCCGTGTATTACTG3´ (denominado Fr3A); para la región J: 5´AACTGCAGAGGAGACGGTGACC3´ (denominado LJH) o 5´GTGACCAGGGT (A/G/C/T) CCTTGGCCCCAG 3' (denominado VLJH). En el primer paso de PCR, 1,5 µl de muestra preparada se añadió a 15 µl de una mezcla conteniendo 1 µM de cada «primer» Fr3A y LJH, 200 µM (cada) dATP, dCTP, dGTP y dTTP, 1,6 mM MgCl2, 50 mM KCl, 10 mM Tris-ClH pH = 9,00, 0,1% Triton X-100 y 0,3 U Taq DNA polimerasa (Promega, Madison, Wi). Se realizaron 37 ciclos de amplificación (desnaturalización a 95° C durante 30 segundos, primer anillamiento a 59° C durante 30 segundos y primera extensión a 72° C durante 20 segundos). Para el segundo pase de PCR, que comprendió 20 ciclos, se añadió 10ml de 1/1000 dilución del primer pase a 30ml de una mezcla con «primres» Fr3A y VLJH. Cada ciclo consintió en la desnaturalización a 94° C durante 2 min., primer anillamiento a 60° C durante 2 min y primera extensión a 72° C durante 2 min. Los controles consistieron en tubos conteniendo: no DNA (control negativo), una muestra conocida de DNA conteniendo un gen Ig reordenado (control positivo de clonalidad) y DNA de un nódulo linfático normal (control de policlonalidad). La monoclonalidad de los linfocitos B se caracteriza por un fragmento de aproximadamente 80-120 bp de longitud. DISCUSIÓN En este estudio se muestra a un paciente que desarrolla dos importantes complicaciones post-tras- REMISIÓN DE ENFERMEDAD POR CMV Y ELPT plante producidas por dos virus diferentes del grupo herpes: enfermedad por CMV severa, manifestada por fiebre, leucopenia, afección gastrointestinal, antigenemia y detección del genoma viral en sangre y tejido gástrico, y ELPT en relación con VEB, manifestada por síntomas constitucionales y digestivos, factores histológicos, factores inmunohistoquímicos, demostración de clonalidad y detección del genoma del VEB en sangre y tejido gástrico. La enfermedad gastrointestinal por CMV es poco frecuente en el trasplante renal, pero generalmente es grave y tiende a recurrir. La recurrencia es aún más severa 11. Aunque muchos casos han remitido con ganciclovir, el tratamiento debe ser más prolongado que cuando hay afectación de otros órganos. En nuestro paciente, la administración de ganciclovir durante 6 semanas curó la enfermedad. Al final del tratamiento, el CMV siguió detectándose en sangre durante un tiempo, pero sin síntomas cínicos. Los cultivos virales y los cambios histopatológicos de la mucosa gástrica son poco sensibles 12, 13. La detección del genoma del CMV por PCR es un método más sensible y específico 14-16, pero debido a su gran sensibilidad, algunos autores piensan que su detección no indica necesariamente enfermedad por CMV 17. En nuestro paciente, el CMV DNA se detectó en las tres biopsias gástricas, aun cuando la endoscopia y la histología no mostraban anormalidades. Este paciente también desarrolló ELPT relacionada con VEB. La enfermedad apareció muy precozmente tras el trasplante 18. Se ha descrito que los niveles elevados de tacrolimus son un factor que favorece el desarrollo de ELPT 19, 20. La presencia de lesiones linfo-epiteliales plantea el diagnóstico diferencial con los procesos linfo-proliferativos tipo MALT, pero en nuestro caso, el polimorfismo celular y la positividad de LMP-1, junto con el carácter destructivo de la lesión, con áreas de necrosis y atipias celulares favorecen el diagnóstico de ELPT 21. La evolución de la ELPT es muy variable. En un número de pacientes las lesiones regresan con la reducción de la inmunosupresión, pero en otros progresan y requieren tratamiento de linfoma 21. El tratamiento óptimo no ha sido definido. Algunos casos responden a la combinación de la reducción de inmunosupresión y de terapia antiviral con aciclovir 22, 23. La curación de nuestro paciente pudo ser debida a la disminución de la inmunosupresión producida por la suspensión del fluconazol, la sustitución de tacrolimus por ciclosporina y al tratamiento con ganciclovir, aunque es posible que la evolución hubiese sido similar si se hubiese disminuido la dosis de tacrolimus sin realizar el cambio a ciclosporina. Franken y cols.24 demostraron la efi- cacia de ganciclovir en un ensayo en ratones. Darenkov y cols. 25 observaron una gran reducción de la incidencia de ELPT con el uso sistemático de ganciclovir como profilaxis para CMV en receptores CMV seropositivos que recibieron globulina antilinfocítica. Otros autores también notaron una disminución de la incidencia de ELPT en pacientes que recibían ganciclovir intravenoso seguido de altas dosis de ganciclovir oral 26, 27. Sin embargo, en sujetos inmunocompetentes, ni el ganciclovir ni el aciclovir son eficaces contra la mononucleosis infecciosa 28. Pirsch y cols. describieron dos casos de ELPT que se resolvieron con tratamiento con ganciclovir, pero previamente se había suspendido la azatioprina y la ciclosporina 29. Más recientemente, Cacciarelli y cols. reportaron que el ganciclovir es eficaz para la ELPT en trasplantes hepáticos pediátricos; en estos casos el tacrolimus se redujo o se suspendió y se reintrodujo cuando había rechazo agudo 30. Aunque no existen datos concluyentes de la eficacia de la terapia antiviral en esta entidad, ya que la mayoría de las células portan el virus de forma latente, los antivirales podrían jugar un papel al prevenir el reclutamiento de nuevas células B infectadas por el virus. En este sentido, el tratamiento precoz instaurado con motivo de la enfermedad por CMV en nuestro paciente podría explicar en parte su buena evolución. En nuestro conocimiento, no se han publicado casos de ELPT grave en receptores adultos de trasplante renal que se recuperen con ganciclovir y sin interrupción de drogas anticalcineurínicas. Otras drogas como el interferón y la inmunoterapia con células killer autólogas activadas son también eficaces, pero la alta tasa de rechazos que conllevan hacen inviable su uso en los pacientes trasplantados 31, 32. Un estudio reciente describe la remisión completa en seis de ocho pacientes tratados con un régimen quimioterápico agresivo, pero con importantes efectos adversos 33. La detección en nuestro paciente de DNA del VEB en sangre periférica antes de la aparición de los síntomas digestivos debe hacer sospechar la aparición de la ELPT. Así, Rogers y cols.34 encuentran que la detección del genoma viral en sangre se correlaciona con la serología y la histología. Un ensayo de PCR semicuantitativo detectó un aumento de los niveles de DNA-VEB circulante, que puede facilitar el diagnóstico precoz de la ELPT y ayudar a monitorizar la terapia 35. Una carga viral elevada ha sido relacionada con un alto riesgo de desarrollar ELPT en trasplantes pediátricos 36. Además, la detección de DNA-VEB en suero indica infección activa, más que latente 37. Más recientemente, Stevens y cols. demostraron que el incremento de la carga de DNAVEB precede y es diagnóstico de ELPT en trasplan579 E. GÓMEZ y cols. tes de pulmón 38. Todos estos datos indican que la detección del genoma viral en sangre periférica puede ser de gran ayuda en el diagnóstico precoz y en el manejo de la ELPT. Últimamente se ha sugerido que la asociación de ELPT y enfermedad por CMV es relativamente frecuente. Walker y cols.39 encontraron que el riesgo de desarrollar una ELPT es más de 100 veces mayor si el donante era seropositivo y el receptor seronegativo para ambos virus. Por otra parte, la infección por CMV puede aumentar la replicación de VEB y producir infección de células B 40. Hornef y cols. demostraron que existía una relación estrecha entre la reactivación de VEB y la enfermedad sintomática por CMV 41. Más recientemente, Mañez y cols. encontraron en un estudio retrospectivo que el factor significativamente asociado con el desarrollo de ELPT fue enfermedad por CMV 42. Estos datos sugieren que la infección por CMV puede favorecer la aparición de desórdenes linfoproliferativos en los receptores VEB seronegativos que reciben un órgano de un donante VEB seropositivo. Por otra parte, las manifestaciones clínicas y endoscópicas de ambas enfermedades pueden confundirse 43, 44. Por este motivo, la ELPT debe ser descartada en este tipo de pacientes. En este sentido, la detección del genoma viral en sangre periférica es un método útil y no agresivo. El diagnóstico precoz de la enfermedad, junto con el empleo de los nuevos tratamientos con anticuerpos monoclonales anti-CD20 (rituximab) puede ser de gran utilidad en el manejo de esta grave enfermedad 45,46, al menos en los casos CD20 positivos como nuestro paciente. El otro factor de riesgo para padecer ambas enfermedades es la sobreinmunosupresión. El fluconazol oral produce un aumento de los niveles de tacrolimus de 1,4 a 3,2 veces, con un pico a los 3 días. Este aumento es dosis-dependiente y la vida media también está aumentada 5. Nuestro paciente tuvo un aumento de los niveles de tacrolimus de, al menos, 2 veces, con un pico en el día 3, y continuaron elevados durante 5 días después de la suspensión del fluconazol. Es posible que el aumento de los niveles de esta droga influyese en el empeoramiento de las dos enfermedades víricas que sufrió nuestro paciente. Osowski y cols.47 encontraron que el fluconazol intravenoso no aumenta los niveles de tacrolimus, lo que es de interés en el manejo de esta droga. En conclusión, con el desarrollo de drogas con gran poder inmunosupresor, la asociación de varias enfermedades virales es siempre una posibilidad a tener en cuenta. La detección del genoma viral en sangre periférica puede ser de gran utilidad en el diagnóstico precoz y el manejo de estas enfermedades. 580 BIBLIOGRAFÍA 1. Ho M: Human cytomegalovirus infection in immunosuppressed patients, in Ho M (ed): Cytomegalovirus: biology and infection, chap 13. New York, Plenum Medical. p. 249-300, 1991. 2. Fishman JA, Rubin RH: Infection in organ-transplant recipients. N Engl J Med 338: 1741-1751, 1998. 3. Gómez E, de Oña M, Aguado S, Tejada F, Núñez M, Portal C, Díaz-Corte C, Sánchez E, Ortega F, Álvarez-Grande J: Cytomegalovirus pre-emptive therapy with ganciclovir in renal transplant patients treated with OKT3. Nephron 74: 367-372, 1996. 4. Rubin RH: Infection in the organ transplant recipient, in Rubin RH and Young LS (eds): clinical approach to infection in the compromised host, chap 24. New York, Plenum Medical, 1994. p. 629-705. 5. Mañez R, Martín M, Raman V, Silverman D, Jain A, Warty V, González-Pinto I, Kusne S, Starzl TE: Fluconazole therapy in transplant recipients receiving FK506. Transplantation 57: 1521-1523, 1994. 6. Gómez E, Melón S, De Oña M, Álvarez R, Laures A, Álvarez-Grande J: Disseminated herpes simplex virus infection in a renal transplant patient as possible cause of repeated urinary extravasations. Nephron 82: 59-64, 1999. 7. Gómez E, De Oña M, Escalada P, Melón S, Aguado S, Villar H, Martínez A, Tejada F, Gago E, Álvarez-Grande J: Diagnóstico rápido de la infección por citomegalovirus en el trasplante renal. Nefrología 13: 467-474, 1993. 8. Stein A, Raoult D: A single method for amplification of DNA from paraffin-embedded tissues. Nucleic Acids Res 20: 52375238, 1992. 9. Merryweather-Clarke AT, Pointon JJ, Shearman JD, Robson KJH: Global prevalence of putative haemochromatosis mutations. J Med Genet 34: 275-278, 1997. 10. Wan JH, Trainor KJ, Brisco MJ, Morley AA: Monoclonality in B cell lymphoma detected in paraffin wax embedded sections using the polymerase chain reaction. J Clin Pathol 43: 888-890, 1990. 11. Shrestha BM, Parton D, Gray A, Shephard D, Griffith D, Westmoreland D, Griffin P, Lord R, Salaman JR, Moore RH: Cytomegalovirus involving gastrointestinal tract in renal transplant recipients. Clin Transplant 10: 170-175, 1996. 12. Culpepper-Morgan JA, Kotler DP, Scholes JV, Tierney AR: Evaluation of diagnostic criteria for mucosal cytomegalic inclusion disease in the acquired immune deficiency syndrome. Am J Gastroenterol 82: 1264-1270, 1987. 13. Francis ND, Boylston AW, Roberts AH, Parkin JM, Pinching AJ: Cytomegalovirus infection in gastrointestinal tracts of patients infected with HIV-1 or AIDS. J Clin Pathol 42: 10551064, 1989. 14. Goodgame RW, Genta RM, Estrada R, Demmler G, Buffone G: Frecuency of positive test for cytomegalovirus in AIDS patients: endoscopic lesions compared with normal mucosa. Am J Gastroenterol 88: 338-343, 1993. 15. Cotte L, Drouet E, Bissuel F, Denoyel GA, Trepo C: Diagnostic value of amplification of human cytomegalovirus DNA from gastrointestinal biopsies from human immunodeficiency virus-infected patients. J Clin Microbiol 31: 2066-2069, 1993. 16. Kusne S, Mañez R, Frye BL, George KST, Abu-Elmagd K, Tabasco-Menguillon J, Fung JJ, Todo S, Rinaldo C, Ehrlich GD: Use of DNA amplification for diagnosis of cytomegalovirus enteritis after intestinal transplantation. Gastroenterology 112: 1121-1128, 1997. 17. Delgado R, Lumbreras C, Alba C, Pedraza MA, Otero JR, Gómez R, Moreno E, Noriega AR, Payá CV: Low predictive REMISIÓN DE ENFERMEDAD POR CMV Y ELPT 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. value of polymerase chain reaction for diagnosis of cytomegalovirus disease in liver transplant recipients. J Clin Microbiol 30: 1876-1878, 1992. Stone RM, Mark EJ, Ferry JA: A 67-year-old renal-transplant recipient with anemia, leucopenia, and pulmonary lesion (Case Record). N Engl J Med 337: 1065-1074, 1997. Cox KL, Lawrence-Miyasaki LS, Garcia-Kennedy R, Lennette ET, Martínez OM, Krams SM, Berquist WE, So SKS, Esquivel CO: An increased incidence of Epstein-Barr virus infection and lymphoproliferative disorders in young children on FK506 after liver transplantation. Transplantation 59: 524529, 1995. Sokal EM, Antunes H, Beguin C, Bodeus M, Wallemaq P, de Goyet JV, Reding R, Janssen M, Buts JP, Otte JB: Early signs and risk factors for the increased incidence of Epstein-Barr virus-related posttransplant lymphoproliferative diseases in pediatric liver transplant recipients treated with tacrolimus. Transplantation 64: 1438-1442, 1997. Harris NL, Ferry JA, Swerdlow SH: Posttransplant lymphoproliferative disorders: summary of Society for Hematopathology Workshop. Semin Diagn Pathol 14: 8-14, 1997. Morgan G, Superina RA. Lymphoproliferative disease after pediatric liver transplantation. J Pediatr Surg 29: 1192-1196, 1994. Morrison VA, Dunn DL, Manivel JC, Gajl-Peczalska KJ, Peterson BA: Clinical characteristics of posttransplant lymphoproliferative disorders. Am J Med 97: 14-24, 1994. Franken M, Estabrooks A, Cavacini L, Sherburne B, Wang F, Scadden DT: Epstein-Barr virus-driven gene therapy for EBVrelated lymphomas. Nat Med 2: 1379-1382, 1996. Darenkov IA, Marcarelli MA, Basadonna GP, Friedman AL, Lorber KM, Howe JG, Crouch J, Bia MJ, Kliger AL, Lorber MI: Reduced incidence of Epstein-Barr virus-associated posttransplant lymphoproliferative disorder using preemptive antiviral therapy. Transplantation 64: 848-852, 1997. Davis CL, Harrison KL, McVicar JP, Forg PJ, Bronner MP, Marsh CL: Antiviral prophylaxis and the Epstein-Barr virus-related posttransplant lymphoprolferative disorder. Clin Transplant 9: 53-59, 1995. Green M, Kaufmann M, Wilson J, Reyes J: Comparison of intravenous ganciclovir followed by oral acyclovir with intravenous ganciclovir alone for prevention of cytomegalovirus and Epstein-Barr virus disease after liver transplantation in children. Clin Infect Dis 25: 1344-1349, 1997. Andersson J. Clinical and immunological considerations in Epstein-Barr virus-associated diseases. Scand J Infect Dis (Supl. 100): 72-82, 1996. Pirsch JD, Stratta RJ, Sollinger HW, Hafez GR, D'Alessandro AM, Kakayoglu M, Belzer FO: Treatment of severe EpsteinBarr virus-induced lymphoproliferative syndrome with ganciclovir: two cases after solid organ transplantation. Am J Med 86: 241-244, 1989. Cacciarelli TV, Green M, Jaffe R, Mazariegos GV, Jain A, Fung JJ, Reyes J: Management of posttransplant lymphoproliferative disease in pediatric liver transplant recipients receiving primary tacrolimus (FK506) therapy. Transplantation 66: 10471052, 1998. O'Brien S, Bernert RA, Logan JL, Lien Y-HH. Remission of posttransplant lymphoproliferative disorder after interferon alfa therapy. J Am Soc Nephrol 8: 1483-1490, 1997. Nalesnik MA, Rao AS, Furukawa H, Phan S Zeevi A, Fung JJ, Klein G, Gritsch HA, Elder E, Whiteride TL, Starzl TE: Autologous lymphokine-activate killer cell therapy of EpsteinBarr virus-positive and ­negative lymphoproliferative disorders arising in organ transplant recipients. Transplantation 63: 1200-1205, 1997. 33. Swinnen LJ, Mullen GM, Carr TJ, Costanzo MR, Fisher RI: Aggressive treatment for poscardiac transplant lymphoproliferation. Blood 86: 3333-3340, 1995. 34. Rogers BB, Conlin C, Timmons CF, Dawsons DB, Krisher K, Andrews WS: Epstein-Barr virus PCR correlated with viral histology and serology in pediatric liver transplant patients. Pediatr Pathol Lab Med 17: 391-400, 1997. 35. Kenagy DN, Schlesinger Y, Weck K, Ritter JH, GaudreaultKeener MM, Storch GA: Epstein-Barr virus DNA in peripheral blood leukocytes of patients with posttransplant lymphoproliferative disease. Transplantation 60: 547-554, 1995. 36. Rowe DT, Qu L, Reyes J, Jabbour N, Yunis E, Putnam P, Todo S, Green M: Use of quantitative competitive PCR to measure Epstein-Barr virus genome load in the perpheral blood of pediatric transplant patients with lymphoproliferative disorders. J Clin Microbiol 35: 1612-1615, 1997. 37. Mouritsen CL, Wittwer CT, Reed G, Khan TM, Martins TB, Jaskowski TD, Litwin CM, Hill HR: Detection of Epstein-Barr viral DNA in serum using rapid-cycle PCR. Biochem Mol Med 60: 161-168, 1997. 38. Stevens SJ, Verschuuren EA, Pronk I, y cols.: Frequent monitoring of Epstein-Barr virus DNA load in unfractionated whole blood is essential for early detection of posttransplant lymphoproliferative disease in high-risk patients. Blood 97: 116571, 2001. 39. Walker RC, Marshall WF, Strickler JG, Wiesner RH, Velosa JA, Habermann TM, McGregor CGA, Paya CV: Pretransplantation assessment of the risk of lymphoproliferative disorder. Clin Infect Dis 20: 1346-1353, 1995. 40. Preiksaitis JK, Díaz-Mitoma F, Mirzayans F, Roberts S, Tyrrel DL: Quantitative orophariyngeal Epstein-Barr virus shedding in renal and cardiac transplant recipients: relationship to immunosuppressive therapy, serologic responses, and the risk of posttransplant lymphoproliferative disorder. J Infec Dis 166: 986-964, 1992. 41. Hornef MW, Bein G, Fricke L, Steinhoff FJ, Wagner H-J, Hinderer W, Sonneborn H-H, Kirchner H: Coincidence of Epstein-Barr virus reactivation, cytomegalovirus infection, and rejection episodes in renal transplant recipients. Transplantation 60: 474-480, 1995. 42. Mañez R, Breinig MC, Linden P, Wilson J, Torre-Cisneros J, Kusne S, Dummer S, Ho M: Posttransplant lymphoproliferative disease in primary Epstein-Barr virus infection after liver transplantation: the role of cytomegalovirus disease. J Infect Dis 176: 1462-1467, 1997. 43. Zucker GM, Otis C, Korowski K, Navab F: Cytomegalovirus gastritis associated with pseudolymphoma. J Clin Gastroenterol 18: 222-226, 1994. 44. Dec GW, Semigran MJ, Vlahakes G, Southern J, Fallon JT: Lymphoma mimics cytomegalovirus-induced hepatitis in a heart transplant recipient. J Heart Lung Transplant 11: 778780, 1992. 45. Serinet MO, Jacquemin E, Habes D y cols.: Anti-CD20 monoclonal antibody (Rituximab) treatment for Epstein-Barr virus-associated, B-lymphoproliferative disease in pediatric liver transplant recipients. J Pediatr Gastroenterol Nutr 35961, 2002. 46. Posttransplant lymphoproliferative disease (PTDL): prevention and treatment. Neprol Dial Transplant 17 (Supl. 4): 31, 2002. 47. Osowski CL, Dix SP, Lin LS, Mullins RE, Geller RB, Wingard JR: Evaluation of the drug interaction between intravenous high-dose fluconazole and cyclosporine or tacrolimus in bone transplant patients. Transplantation 61: 1268-1272, 1996. 581
Idiomas
Nefrología

Suscríbase a la newsletter

Opciones de artículo
Herramientas
es en

¿Es usted profesional sanitario apto para prescribir o dispensar medicamentos?

Are you a health professional able to prescribe or dispense drugs?